Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:AFF4-FSTL4

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: AFF4-FSTL4
	FusionPDB ID: 2702
	FusionGDB2.0 ID: 2702
		Hgene	Tgene
	Gene symbol	AFF4	FSTL4
	Gene ID	27125	23105
	Gene name	AF4/FMR2 family member 4	follistatin like 4
	Synonyms	AF5Q31\|CHOPS\|MCEF	-
	Cytomap	5q31.1	5q31.1
	Type of gene	protein-coding	protein-coding
	Description	AF4/FMR2 family member 4ALL1-fused gene from chromosome 5q31 proteinmajor CDK9 elongation factor-associated protein	follistatin-related protein 4follistatin-like protein 4
	Modification date	20200315	20200313
	UniProtAcc	Q9UHB7 Main function of 5'-partner protein: FUNCTION: Key component of the super elongation complex (SEC), a complex required to increase the catalytic rate of RNA polymerase II transcription by suppressing transient pausing by the polymerase at multiple sites along the DNA. In the SEC complex, AFF4 acts as a central scaffold that recruits other factors through direct interactions with ELL proteins (ELL, ELL2 or ELL3) and the P-TEFb complex. In case of infection by HIV-1 virus, the SEC complex is recruited by the viral Tat protein to stimulate viral gene expression. {ECO:0000269\|PubMed:20159561, ECO:0000269\|PubMed:20471948, ECO:0000269\|PubMed:23251033}.	Q6MZW2 Main function of 5'-partner protein:
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000265343, ENST00000378595, ENST00000491831,	ENST00000507112, ENST00000265342,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	12 X 10 X 6=720	3 X 3 X 2=18
	# samples	14	3
	** MAII score	log2(14/720*10)=-2.36257007938471 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(3/18*10)=0.736965594166206 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0
Fusion gene context	PubMed: AFF4 [Title/Abstract] AND FSTL4 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: AFF4 [Title/Abstract] AND FSTL4 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	AFF4(132224771)-FSTL4(132561511), # samples:2
Anticipated loss of major functional domain due to fusion event.	AFF4-FSTL4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. AFF4-FSTL4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. AFF4-FSTL4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. AFF4-FSTL4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. AFF4-FSTL4 seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. AFF4-FSTL4 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr5:132224771/chr5:132561511)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across AFF4 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across FSTL4 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst

Tenst

Hgene

Hchr

Hbp

Hstrand

Tgene

Tchr

Tbp

Tstrand

Seq length
(transcript)

BP loci
(transcript)

Predicted start
(transcript)

Predicted stop
(transcript)

Seq length
(amino acids)

ENST00000265343

AFF4

chr5

132224771

ENST00000265342

FSTL4

chr5

132561511

7266

3112

380

3190

936

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000265343	ENST00000265342	AFF4	chr5	132224771	-	FSTL4	chr5	132561511	-	0.002123665	0.9978763

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for AFF4-FSTL4

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
AFF4	chr5	132224771	FSTL4	chr5	132561511	3112	910	SSKPRRTKLVFDDSAASHPCLSREPG

Top

Potential FusionNeoAntigen Information of AFF4-FSTL4 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

AFF4-FSTL4_132224771_132561511.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	HLA-C04:10	VFDDSAASH	0.9959	0.8145	9	18
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	HLA-C04:07	VFDDSAASH	0.9951	0.8056	9	18
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	HLA-C04:01	VFDDSAASH	0.9951	0.8056	9	18

Top

Potential FusionNeoAntigen Information of AFF4-FSTL4 in HLA II

AFF4-FSTL4_132224771_132561511.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0301	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0305	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0307	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0310	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0313	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0315	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0318	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0320	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0322	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0324	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0326	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0326	RTKLVFDDSAASHPC	5	20
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0326	PRRTKLVFDDSAASH	3	18
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0328	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0330	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0332	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0334	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0336	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0340	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0342	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0342	RTKLVFDDSAASHPC	5	20
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0342	PRRTKLVFDDSAASH	3	18
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0344	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0346	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0348	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0350	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0352	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0354	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0401	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0401	RTKLVFDDSAASHPC	5	20
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0401	PRRTKLVFDDSAASH	3	18
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0413	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0413	RTKLVFDDSAASHPC	5	20
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0413	PRRTKLVFDDSAASH	3	18
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0419	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0422	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0422	RTKLVFDDSAASHPC	5	20
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0422	PRRTKLVFDDSAASH	3	18
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0422	TKLVFDDSAASHPCL	6	21
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0433	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0433	RTKLVFDDSAASHPC	5	20
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0433	PRRTKLVFDDSAASH	3	18
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0434	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0434	RTKLVFDDSAASHPC	5	20
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0434	PRRTKLVFDDSAASH	3	18
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0435	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0435	RTKLVFDDSAASHPC	5	20
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0435	PRRTKLVFDDSAASH	3	18
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0438	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0438	RTKLVFDDSAASHPC	5	20
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0438	PRRTKLVFDDSAASH	3	18
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0440	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0444	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0444	RTKLVFDDSAASHPC	5	20
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0444	PRRTKLVFDDSAASH	3	18
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0461	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0462	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0463	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0463	RTKLVFDDSAASHPC	5	20
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0463	PRRTKLVFDDSAASH	3	18
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0464	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0464	RTKLVFDDSAASHPC	5	20
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0464	PRRTKLVFDDSAASH	3	18
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0466	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0466	RTKLVFDDSAASHPC	5	20
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0466	PRRTKLVFDDSAASH	3	18
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0467	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0468	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0470	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0472	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0472	RTKLVFDDSAASHPC	5	20
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0472	PRRTKLVFDDSAASH	3	18
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0472	TKLVFDDSAASHPCL	6	21
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0474	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0474	RTKLVFDDSAASHPC	5	20
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0474	PRRTKLVFDDSAASH	3	18
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0475	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0476	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0476	RTKLVFDDSAASHPC	5	20
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0476	PRRTKLVFDDSAASH	3	18
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0479	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-0479	RTKLVFDDSAASHPC	5	20
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-1107	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-1179	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-1419	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-1476	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-1479	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-1525	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-1525	RTKLVFDDSAASHPC	5	20
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB1-1525	PRRTKLVFDDSAASH	3	18
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB3-0101	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB3-0104	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB3-0105	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB3-0108	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB3-0111	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB3-0112	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB3-0113	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB3-0114	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB3-0201	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB3-0204	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB3-0204	RTKLVFDDSAASHPC	5	20
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB3-0204	PRRTKLVFDDSAASH	3	18
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB3-0205	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB3-0213	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB3-0214	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB3-0217	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB3-0219	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB3-0222	RRTKLVFDDSAASHP	4	19
AFF4-FSTL4	chr5	132224771	chr5	132561511	3112	DRB3-0224	RRTKLVFDDSAASHP	4	19

Top

Fusion breakpoint peptide structures of AFF4-FSTL4

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
9440	TKLVFDDSAASHPC	AFF4	FSTL4	chr5	132224771	chr5	132561511	3112

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of AFF4-FSTL4

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	9440	TKLVFDDSAASHPC	-7.15543	-7.26883
HLA-B14:02	3BVN	9440	TKLVFDDSAASHPC	-4.77435	-5.80965
HLA-B52:01	3W39	9440	TKLVFDDSAASHPC	-6.80875	-6.92215
HLA-B52:01	3W39	9440	TKLVFDDSAASHPC	-4.20386	-5.23916
HLA-A11:01	4UQ2	9440	TKLVFDDSAASHPC	-7.5194	-8.5547
HLA-A11:01	4UQ2	9440	TKLVFDDSAASHPC	-6.9601	-7.0735
HLA-A24:02	5HGA	9440	TKLVFDDSAASHPC	-7.52403	-7.63743
HLA-A24:02	5HGA	9440	TKLVFDDSAASHPC	-5.82433	-6.85963
HLA-B27:05	6PYJ	9440	TKLVFDDSAASHPC	-3.28285	-4.31815
HLA-B44:05	3DX8	9440	TKLVFDDSAASHPC	-5.91172	-6.94702
HLA-B44:05	3DX8	9440	TKLVFDDSAASHPC	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of AFF4-FSTL4

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
AFF4-FSTL4	chr5	132224771	chr5	132561511	9	18	VFDDSAASH	CTTTGATGACAGTGCCGCCAGTCATCC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
AFF4-FSTL4	chr5	132224771	chr5	132561511	3	18	PRRTKLVFDDSAASH	TCGGAGAACAAAGCTTGTCTTTGATGACAGTGCCGCCAGTCATCC
AFF4-FSTL4	chr5	132224771	chr5	132561511	4	19	RRTKLVFDDSAASHP	GAGAACAAAGCTTGTCTTTGATGACAGTGCCGCCAGTCATCCGTG
AFF4-FSTL4	chr5	132224771	chr5	132561511	5	20	RTKLVFDDSAASHPC	AACAAAGCTTGTCTTTGATGACAGTGCCGCCAGTCATCCGTGTCT
AFF4-FSTL4	chr5	132224771	chr5	132561511	6	21	TKLVFDDSAASHPCL	AAAGCTTGTCTTTGATGACAGTGCCGCCAGTCATCCGTGTCTATC

Top

Information of the samples that have these potential fusion neoantigens of AFF4-FSTL4

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	AFF4-FSTL4	chr5	132224771	ENST00000265343	chr5	132561511	ENST00000265342	TCGA-E2-A1LE-01A

Top

Potential target of CAR-T therapy development for AFF4-FSTL4

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to AFF4-FSTL4

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to AFF4-FSTL4

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Hgene	AFF4	C0000772	Multiple congenital anomalies	1	CTD_human
Hgene	AFF4	C0005941	Bone Diseases, Developmental	1	CTD_human
Hgene	AFF4	C0009241	Cognition Disorders	1	CTD_human
Hgene	AFF4	C0018273	Growth Disorders	1	CTD_human
Hgene	AFF4	C0018798	Congenital Heart Defects	1	CTD_human
Hgene	AFF4	C0024115	Lung diseases	1	CTD_human
Hgene	AFF4	C0028754	Obesity	1	CTD_human
Hgene	AFF4	C0282631	Facies	1	CTD_human
Hgene	AFF4	C4085597	CHOPS SYNDROME	1	CTD_human;ORPHANET;UNIPROT

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)