Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ERBB2-CDK12

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ERBB2-CDK12
	FusionPDB ID: 27142
	FusionGDB2.0 ID: 27142
		Hgene	Tgene
	Gene symbol	ERBB2	CDK12
	Gene ID	2064	51755
	Gene name	erb-b2 receptor tyrosine kinase 2	cyclin dependent kinase 12
	Synonyms	CD340\|HER-2\|HER-2/neu\|HER2\|MLN 19\|NEU\|NGL\|TKR1	CRK7\|CRKR\|CRKRS
	Cytomap	17q12	17q12
	Type of gene	protein-coding	protein-coding
	Description	receptor tyrosine-protein kinase erbB-2c-erb B2/neu proteinherstatinhuman epidermal growth factor receptor 2metastatic lymph node gene 19 proteinneuro/glioblastoma derived oncogene homologneuroblastoma/glioblastoma derived oncogene homologp185erbB2	cyclin-dependent kinase 12CDC2-related protein kinase 7Cdc2-related kinase, arginine/serine-richcell division cycle 2-related protein kinase 7cell division protein kinase 12
	Modification date	20200329	20200313
	UniProtAcc	P04626 Main function of 5'-partner protein: FUNCTION: Protein tyrosine kinase that is part of several cell surface receptor complexes, but that apparently needs a coreceptor for ligand binding. Essential component of a neuregulin-receptor complex, although neuregulins do not interact with it alone. GP30 is a potential ligand for this receptor. Regulates outgrowth and stabilization of peripheral microtubules (MTs). Upon ERBB2 activation, the MEMO1-RHOA-DIAPH1 signaling pathway elicits the phosphorylation and thus the inhibition of GSK3B at cell membrane. This prevents the phosphorylation of APC and CLASP2, allowing its association with the cell membrane. In turn, membrane-bound APC allows the localization of MACF1 to the cell membrane, which is required for microtubule capture and stabilization. {ECO:0000305}.; FUNCTION: In the nucleus is involved in transcriptional regulation. Associates with the 5'-TCAAATTC-3' sequence in the PTGS2/COX-2 promoter and activates its transcription. Implicated in transcriptional activation of CDKN1A; the function involves STAT3 and SRC. Involved in the transcription of rRNA genes by RNA Pol I and enhances protein synthesis and cell growth. {ECO:0000269\|PubMed:10358079, ECO:0000269\|PubMed:15380516, ECO:0000269\|PubMed:21555369}.	Q9NYV4 Main function of 5'-partner protein: FUNCTION: Cyclin-dependent kinase that phosphorylates the C-terminal domain (CTD) of the large subunit of RNA polymerase II (POLR2A), thereby acting as a key regulator of transcription elongation. Regulates the expression of genes involved in DNA repair and is required for the maintenance of genomic stability. Preferentially phosphorylates 'Ser-5' in CTD repeats that are already phosphorylated at 'Ser-7', but can also phosphorylate 'Ser-2'. Required for RNA splicing, possibly by phosphorylating SRSF1/SF2. Involved in regulation of MAP kinase activity, possibly leading to affect the response to estrogen inhibitors. {ECO:0000269\|PubMed:11683387, ECO:0000269\|PubMed:19651820, ECO:0000269\|PubMed:20952539, ECO:0000269\|PubMed:22012619, ECO:0000269\|PubMed:24662513}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000269571, ENST00000406381, ENST00000445658, ENST00000540042, ENST00000540147, ENST00000541774, ENST00000578199, ENST00000584450, ENST00000584601, ENST00000584888,	ENST00000559545, ENST00000430627, ENST00000447079,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	50 X 44 X 14=30800	36 X 30 X 14=15120
	# samples	73	55
	** MAII score	log2(73/30800*10)=-5.39889007670225 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(55/15120*10)=-4.78088271069641 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ERBB2 [Title/Abstract] AND CDK12 [Title/Abstract] AND fusion [Title/Abstract] A Pan-Cancer Compendium of Genes Deregulated by Somatic Genomic Rearrangement across More Than 1,400 Cases (pmid: 29996110)
Fusion neoantigen context	PubMed: ERBB2 [Title/Abstract] AND CDK12 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ERBB2(37868701)-CDK12(37680927), # samples:2 CDK12(37657692)-ERBB2(37851240), # samples:1 CDK12(37657692)-ERBB2(37851241), # samples:1
Anticipated loss of major functional domain due to fusion event.	ERBB2-CDK12 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ERBB2-CDK12 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ERBB2-CDK12 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ERBB2-CDK12 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	ERBB2	GO:0007165	signal transduction	10572067
Hgene	ERBB2	GO:0007166	cell surface receptor signaling pathway	9685399
Hgene	ERBB2	GO:0007169	transmembrane receptor protein tyrosine kinase signaling pathway	7514177
Hgene	ERBB2	GO:0014065	phosphatidylinositol 3-kinase signaling	7556068
Hgene	ERBB2	GO:0018108	peptidyl-tyrosine phosphorylation	12000754
Hgene	ERBB2	GO:0032886	regulation of microtubule-based process	20937854
Hgene	ERBB2	GO:0035556	intracellular signal transduction	19372587
Hgene	ERBB2	GO:0042060	wound healing	12646923
Hgene	ERBB2	GO:0043406	positive regulation of MAP kinase activity	10572067
Hgene	ERBB2	GO:0045785	positive regulation of cell adhesion	7556068
Hgene	ERBB2	GO:0046777	protein autophosphorylation	7556068
Hgene	ERBB2	GO:0050679	positive regulation of epithelial cell proliferation	10572067
Hgene	ERBB2	GO:0071363	cellular response to growth factor stimulus	20010870
Hgene	ERBB2	GO:0090314	positive regulation of protein targeting to membrane	20010870
Tgene	CDK12	GO:0046777	protein autophosphorylation	11683387

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:37868701/chr17:37680927)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ERBB2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across CDK12 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000584601	ERBB2	chr17	37868701	+	ENST00000430627	CDK12	chr17	37680926	+	4367	1855	752	3205	817
ENST00000584601	ERBB2	chr17	37868701	+	ENST00000447079	CDK12	chr17	37680926	+	7063	1855	752	3232	826
ENST00000406381	ERBB2	chr17	37868701	+	ENST00000430627	CDK12	chr17	37680926	+	4080	1568	510	2918	802
ENST00000406381	ERBB2	chr17	37868701	+	ENST00000447079	CDK12	chr17	37680926	+	6776	1568	510	2945	811
ENST00000541774	ERBB2	chr17	37868701	+	ENST00000430627	CDK12	chr17	37680926	+	3615	1103	0	2453	817
ENST00000541774	ERBB2	chr17	37868701	+	ENST00000447079	CDK12	chr17	37680926	+	6311	1103	0	2480	826
ENST00000445658	ERBB2	chr17	37868701	+	ENST00000430627	CDK12	chr17	37680926	+	3095	583	50	1933	627
ENST00000445658	ERBB2	chr17	37868701	+	ENST00000447079	CDK12	chr17	37680926	+	5791	583	50	1960	636
ENST00000540147	ERBB2	chr17	37868701	+	ENST00000430627	CDK12	chr17	37680926	+	3898	1386	25	2736	903
ENST00000540147	ERBB2	chr17	37868701	+	ENST00000447079	CDK12	chr17	37680926	+	6594	1386	25	2763	912
ENST00000584450	ERBB2	chr17	37868701	+	ENST00000430627	CDK12	chr17	37680926	+	3875	1363	2	2713	903
ENST00000584450	ERBB2	chr17	37868701	+	ENST00000447079	CDK12	chr17	37680926	+	6571	1363	2	2740	912
ENST00000269571	ERBB2	chr17	37868701	+	ENST00000430627	CDK12	chr17	37680926	+	3819	1307	57	2657	866
ENST00000269571	ERBB2	chr17	37868701	+	ENST00000447079	CDK12	chr17	37680926	+	6515	1307	57	2684	875
ENST00000578199	ERBB2	chr17	37868701	+	ENST00000430627	CDK12	chr17	37680926	+	4111	1599	541	2949	802
ENST00000578199	ERBB2	chr17	37868701	+	ENST00000447079	CDK12	chr17	37680926	+	6807	1599	541	2976	811
ENST00000540042	ERBB2	chr17	37868701	+	ENST00000430627	CDK12	chr17	37680926	+	3736	1224	166	2574	802
ENST00000540042	ERBB2	chr17	37868701	+	ENST00000447079	CDK12	chr17	37680926	+	6432	1224	166	2601	811
ENST00000584601	ERBB2	chr17	37868701	+	ENST00000430627	CDK12	chr17	37680927	+	4367	1855	752	3205	817
ENST00000584601	ERBB2	chr17	37868701	+	ENST00000447079	CDK12	chr17	37680927	+	7063	1855	752	3232	826
ENST00000406381	ERBB2	chr17	37868701	+	ENST00000430627	CDK12	chr17	37680927	+	4080	1568	510	2918	802
ENST00000406381	ERBB2	chr17	37868701	+	ENST00000447079	CDK12	chr17	37680927	+	6776	1568	510	2945	811
ENST00000541774	ERBB2	chr17	37868701	+	ENST00000430627	CDK12	chr17	37680927	+	3615	1103	0	2453	817
ENST00000541774	ERBB2	chr17	37868701	+	ENST00000447079	CDK12	chr17	37680927	+	6311	1103	0	2480	826
ENST00000445658	ERBB2	chr17	37868701	+	ENST00000430627	CDK12	chr17	37680927	+	3095	583	50	1933	627
ENST00000445658	ERBB2	chr17	37868701	+	ENST00000447079	CDK12	chr17	37680927	+	5791	583	50	1960	636
ENST00000540147	ERBB2	chr17	37868701	+	ENST00000430627	CDK12	chr17	37680927	+	3898	1386	25	2736	903
ENST00000540147	ERBB2	chr17	37868701	+	ENST00000447079	CDK12	chr17	37680927	+	6594	1386	25	2763	912
ENST00000584450	ERBB2	chr17	37868701	+	ENST00000430627	CDK12	chr17	37680927	+	3875	1363	2	2713	903
ENST00000584450	ERBB2	chr17	37868701	+	ENST00000447079	CDK12	chr17	37680927	+	6571	1363	2	2740	912
ENST00000269571	ERBB2	chr17	37868701	+	ENST00000430627	CDK12	chr17	37680927	+	3819	1307	57	2657	866
ENST00000269571	ERBB2	chr17	37868701	+	ENST00000447079	CDK12	chr17	37680927	+	6515	1307	57	2684	875
ENST00000578199	ERBB2	chr17	37868701	+	ENST00000430627	CDK12	chr17	37680927	+	4111	1599	541	2949	802
ENST00000578199	ERBB2	chr17	37868701	+	ENST00000447079	CDK12	chr17	37680927	+	6807	1599	541	2976	811
ENST00000540042	ERBB2	chr17	37868701	+	ENST00000430627	CDK12	chr17	37680927	+	3736	1224	166	2574	802
ENST00000540042	ERBB2	chr17	37868701	+	ENST00000447079	CDK12	chr17	37680927	+	6432	1224	166	2601	811

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000584601	ENST00000430627	ERBB2	chr17	37868701	+	CDK12	chr17	37680926	+	0.006705823	0.99329424
ENST00000584601	ENST00000447079	ERBB2	chr17	37868701	+	CDK12	chr17	37680926	+	0.001293116	0.99870694
ENST00000406381	ENST00000430627	ERBB2	chr17	37868701	+	CDK12	chr17	37680926	+	0.006065635	0.99393433
ENST00000406381	ENST00000447079	ERBB2	chr17	37868701	+	CDK12	chr17	37680926	+	0.000667466	0.9993325
ENST00000541774	ENST00000430627	ERBB2	chr17	37868701	+	CDK12	chr17	37680926	+	0.007548648	0.99245137
ENST00000541774	ENST00000447079	ERBB2	chr17	37868701	+	CDK12	chr17	37680926	+	0.001213167	0.99878687
ENST00000445658	ENST00000430627	ERBB2	chr17	37868701	+	CDK12	chr17	37680926	+	0.009612149	0.99038786
ENST00000445658	ENST00000447079	ERBB2	chr17	37868701	+	CDK12	chr17	37680926	+	0.000579946	0.99942005
ENST00000540147	ENST00000430627	ERBB2	chr17	37868701	+	CDK12	chr17	37680926	+	0.009088472	0.99091154
ENST00000540147	ENST00000447079	ERBB2	chr17	37868701	+	CDK12	chr17	37680926	+	0.001409122	0.9985909
ENST00000584450	ENST00000430627	ERBB2	chr17	37868701	+	CDK12	chr17	37680926	+	0.009231557	0.9907685
ENST00000584450	ENST00000447079	ERBB2	chr17	37868701	+	CDK12	chr17	37680926	+	0.001415898	0.99858415
ENST00000269571	ENST00000430627	ERBB2	chr17	37868701	+	CDK12	chr17	37680926	+	0.009141657	0.9908584
ENST00000269571	ENST00000447079	ERBB2	chr17	37868701	+	CDK12	chr17	37680926	+	0.001410708	0.9985892
ENST00000578199	ENST00000430627	ERBB2	chr17	37868701	+	CDK12	chr17	37680926	+	0.005341482	0.9946585
ENST00000578199	ENST00000447079	ERBB2	chr17	37868701	+	CDK12	chr17	37680926	+	0.000609903	0.9993901
ENST00000540042	ENST00000430627	ERBB2	chr17	37868701	+	CDK12	chr17	37680926	+	0.006051069	0.99394894
ENST00000540042	ENST00000447079	ERBB2	chr17	37868701	+	CDK12	chr17	37680926	+	0.000580031	0.99942005
ENST00000584601	ENST00000430627	ERBB2	chr17	37868701	+	CDK12	chr17	37680927	+	0.006705823	0.99329424
ENST00000584601	ENST00000447079	ERBB2	chr17	37868701	+	CDK12	chr17	37680927	+	0.001293116	0.99870694
ENST00000406381	ENST00000430627	ERBB2	chr17	37868701	+	CDK12	chr17	37680927	+	0.006065635	0.99393433
ENST00000406381	ENST00000447079	ERBB2	chr17	37868701	+	CDK12	chr17	37680927	+	0.000667466	0.9993325
ENST00000541774	ENST00000430627	ERBB2	chr17	37868701	+	CDK12	chr17	37680927	+	0.007548648	0.99245137
ENST00000541774	ENST00000447079	ERBB2	chr17	37868701	+	CDK12	chr17	37680927	+	0.001213167	0.99878687
ENST00000445658	ENST00000430627	ERBB2	chr17	37868701	+	CDK12	chr17	37680927	+	0.009612149	0.99038786
ENST00000445658	ENST00000447079	ERBB2	chr17	37868701	+	CDK12	chr17	37680927	+	0.000579946	0.99942005
ENST00000540147	ENST00000430627	ERBB2	chr17	37868701	+	CDK12	chr17	37680927	+	0.009088472	0.99091154
ENST00000540147	ENST00000447079	ERBB2	chr17	37868701	+	CDK12	chr17	37680927	+	0.001409122	0.9985909
ENST00000584450	ENST00000430627	ERBB2	chr17	37868701	+	CDK12	chr17	37680927	+	0.009231557	0.9907685
ENST00000584450	ENST00000447079	ERBB2	chr17	37868701	+	CDK12	chr17	37680927	+	0.001415898	0.99858415
ENST00000269571	ENST00000430627	ERBB2	chr17	37868701	+	CDK12	chr17	37680927	+	0.009141657	0.9908584
ENST00000269571	ENST00000447079	ERBB2	chr17	37868701	+	CDK12	chr17	37680927	+	0.001410708	0.9985892
ENST00000578199	ENST00000430627	ERBB2	chr17	37868701	+	CDK12	chr17	37680927	+	0.005341482	0.9946585
ENST00000578199	ENST00000447079	ERBB2	chr17	37868701	+	CDK12	chr17	37680927	+	0.000609903	0.9993901
ENST00000540042	ENST00000430627	ERBB2	chr17	37868701	+	CDK12	chr17	37680927	+	0.006051069	0.99394894
ENST00000540042	ENST00000447079	ERBB2	chr17	37868701	+	CDK12	chr17	37680927	+	0.000580031	0.99942005

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ERBB2-CDK12

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ERBB2	chr17	37868701	CDK12	chr17	37680926	1103	364	CKKIFGSLAFLPESFDGLPHWQDCHE
ERBB2	chr17	37868701	CDK12	chr17	37680926	1224	349	CKKIFGSLAFLPESFDGLPHWQDCHE
ERBB2	chr17	37868701	CDK12	chr17	37680926	1307	413	CKKIFGSLAFLPESFDGLPHWQDCHE
ERBB2	chr17	37868701	CDK12	chr17	37680926	1363	450	CKKIFGSLAFLPESFDGLPHWQDCHE
ERBB2	chr17	37868701	CDK12	chr17	37680926	1386	450	CKKIFGSLAFLPESFDGLPHWQDCHE
ERBB2	chr17	37868701	CDK12	chr17	37680926	1568	349	CKKIFGSLAFLPESFDGLPHWQDCHE
ERBB2	chr17	37868701	CDK12	chr17	37680926	1599	349	CKKIFGSLAFLPESFDGLPHWQDCHE
ERBB2	chr17	37868701	CDK12	chr17	37680926	1855	364	CKKIFGSLAFLPESFDGLPHWQDCHE
ERBB2	chr17	37868701	CDK12	chr17	37680926	583	174	CKKIFGSLAFLPESFDGLPHWQDCHE
ERBB2	chr17	37868701	CDK12	chr17	37680927	1103	364	CKKIFGSLAFLPESFDGLPHWQDCHE
ERBB2	chr17	37868701	CDK12	chr17	37680927	1224	349	CKKIFGSLAFLPESFDGLPHWQDCHE
ERBB2	chr17	37868701	CDK12	chr17	37680927	1307	413	CKKIFGSLAFLPESFDGLPHWQDCHE
ERBB2	chr17	37868701	CDK12	chr17	37680927	1363	450	CKKIFGSLAFLPESFDGLPHWQDCHE
ERBB2	chr17	37868701	CDK12	chr17	37680927	1386	450	CKKIFGSLAFLPESFDGLPHWQDCHE
ERBB2	chr17	37868701	CDK12	chr17	37680927	1568	349	CKKIFGSLAFLPESFDGLPHWQDCHE
ERBB2	chr17	37868701	CDK12	chr17	37680927	1599	349	CKKIFGSLAFLPESFDGLPHWQDCHE
ERBB2	chr17	37868701	CDK12	chr17	37680927	1855	364	CKKIFGSLAFLPESFDGLPHWQDCHE
ERBB2	chr17	37868701	CDK12	chr17	37680927	583	174	CKKIFGSLAFLPESFDGLPHWQDCHE

Top

Potential FusionNeoAntigen Information of ERBB2-CDK12 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ERBB2-CDK12_37868701_37680926.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B57:01	ESFDGLPHW	0.9929	0.9967	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B58:01	ESFDGLPHW	0.9906	0.9932	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B53:01	ESFDGLPHW	0.9871	0.8283	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A02:22	FLPESFDGL	0.9836	0.7445	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B58:02	ESFDGLPHW	0.9834	0.9827	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A02:24	FLPESFDGL	0.9816	0.6587	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A02:30	FLPESFDGL	0.9816	0.6587	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A02:67	FLPESFDGL	0.9816	0.6587	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A02:11	FLPESFDGL	0.981	0.6951	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A02:60	FLPESFDGL	0.9807	0.6517	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B15:17	ESFDGLPHW	0.9801	0.9891	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A02:21	FLPESFDGL	0.9789	0.7756	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A26:02	ESFDGLPHW	0.9704	0.9304	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A02:04	FLPESFDGL	0.962	0.6634	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A02:27	FLPESFDGL	0.9588	0.7115	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A02:16	FLPESFDGL	0.9579	0.5535	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A02:35	FLPESFDGL	0.9555	0.7114	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B15:16	ESFDGLPHW	0.9527	0.9821	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A02:13	FLPESFDGL	0.9485	0.7525	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A02:29	FLPESFDGL	0.9416	0.6643	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A26:14	ESFDGLPHW	0.9323	0.9187	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A26:15	ESFDGLPHW	0.9323	0.9187	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A02:20	FLPESFDGL	0.9237	0.6678	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A02:38	FLPESFDGL	0.8773	0.6542	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B57:03	ESFDGLPHW	0.8037	0.9979	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A66:01	ESFDGLPHW	0.7863	0.9104	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A26:03	ESFDGLPHW	0.7846	0.912	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A31:08	ESFDGLPHW	0.6363	0.8199	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A32:13	ESFDGLPHW	0.5756	0.9984	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A26:08	ESFDGLPHW	0.5047	0.8815	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B57:01	PESFDGLPHW	0.9968	0.9969	11	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B44:02	PESFDGLPHW	0.9864	0.8423	11	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B44:03	PESFDGLPHW	0.9794	0.9892	11	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B58:02	PESFDGLPHW	0.9768	0.9821	11	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B58:01	PESFDGLPHW	0.9737	0.9936	11	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B57:01	LPESFDGLPHW	0.9999	0.9973	10	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B58:02	LPESFDGLPHW	0.9996	0.9898	10	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B53:01	LPESFDGLPHW	0.9987	0.9178	10	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B58:01	LPESFDGLPHW	0.9982	0.9956	10	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B15:16	LPESFDGLPHW	0.9953	0.9894	10	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B57:03	LPESFDGLPHW	0.9943	0.9993	10	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B15:17	LPESFDGLPHW	0.993	0.9935	10	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A02:02	FLPESFDGL	0.9845	0.6157	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A02:07	FLPESFDGL	0.9824	0.746	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A02:05	FLPESFDGL	0.9822	0.742	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A02:01	FLPESFDGL	0.9816	0.6587	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A26:01	ESFDGLPHW	0.9323	0.9187	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-C04:10	FLPESFDGL	0.9094	0.6273	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-C04:07	FLPESFDGL	0.9049	0.6643	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B44:08	ESFDGLPHW	0.8734	0.9179	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B44:06	ESFDGLPHW	0.8548	0.6542	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-C04:06	FLPESFDGL	0.847	0.7126	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-C01:17	FLPESFDGL	0.7895	0.9698	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-C04:14	FLPESFDGL	0.7809	0.6105	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-C01:30	FLPESFDGL	0.3026	0.9742	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-C07:13	FLPESFDGL	0.2882	0.9395	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-C07:29	FLPESFDGL	0.2285	0.9749	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B44:04	PESFDGLPHW	0.9937	0.7358	11	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A02:07	AFLPESFDGL	0.6464	0.6788	8	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B44:06	LPESFDGLPHW	0.9956	0.7318	10	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B57:04	ESFDGLPHW	0.9936	0.9183	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A25:01	ESFDGLPHW	0.9931	0.9835	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B57:10	ESFDGLPHW	0.9929	0.9967	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A02:03	FLPESFDGL	0.9811	0.8011	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B57:02	ESFDGLPHW	0.9794	0.9877	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A02:14	FLPESFDGL	0.9794	0.7617	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A02:06	FLPESFDGL	0.9789	0.7756	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B15:13	ESFDGLPHW	0.969	0.973	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B53:02	ESFDGLPHW	0.969	0.9309	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B58:06	ESFDGLPHW	0.9672	0.9773	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-C04:03	FLPESFDGL	0.9187	0.6932	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-C04:01	FLPESFDGL	0.9049	0.6643	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-C01:03	FLPESFDGL	0.8353	0.8687	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-C01:02	FLPESFDGL	0.779	0.9683	9	18
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-A32:01	ESFDGLPHW	0.523	0.9984	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B15:24	ESFDGLPHW	0.4229	0.991	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B51:06	ESFDGLPHW	0.3224	0.9674	12	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B57:10	PESFDGLPHW	0.9968	0.9969	11	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B44:21	PESFDGLPHW	0.9876	0.6889	11	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B44:22	PESFDGLPHW	0.9864	0.8423	11	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B44:26	PESFDGLPHW	0.9794	0.9892	11	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B44:13	PESFDGLPHW	0.9794	0.9892	11	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B44:07	PESFDGLPHW	0.9794	0.9892	11	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B57:10	LPESFDGLPHW	0.9999	0.9973	10	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B57:04	LPESFDGLPHW	0.9996	0.9567	10	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B57:02	LPESFDGLPHW	0.9986	0.9944	10	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B58:06	LPESFDGLPHW	0.9985	0.9835	10	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B15:13	LPESFDGLPHW	0.9983	0.9848	10	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B53:02	LPESFDGLPHW	0.9983	0.9168	10	21
ERBB2-CDK12	chr17	37868701	chr17	37680926	1307	HLA-B51:06	LPESFDGLPHW	0.8951	0.9365	10	21

Top

Potential FusionNeoAntigen Information of ERBB2-CDK12 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of ERBB2-CDK12

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
8722	SLAFLPESFDGLPH	ERBB2	CDK12	chr17	37868701	chr17	37680926	1307

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ERBB2-CDK12

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B52:01	3W39	8722	SLAFLPESFDGLPH	-2.77966	-2.77966
HLA-B44:05	3DX8	8722	SLAFLPESFDGLPH	-3.64687	-3.64687

Top

Vaccine Design for the FusionNeoAntigens of ERBB2-CDK12

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ERBB2-CDK12	chr17	37868701	chr17	37680926	10	21	LPESFDGLPHW	CTTTGATGGCCTCCCCCACTGGCAGGATTGCCA
ERBB2-CDK12	chr17	37868701	chr17	37680926	11	21	PESFDGLPHW	TGATGGCCTCCCCCACTGGCAGGATTGCCA
ERBB2-CDK12	chr17	37868701	chr17	37680926	12	21	ESFDGLPHW	TGGCCTCCCCCACTGGCAGGATTGCCA
ERBB2-CDK12	chr17	37868701	chr17	37680926	8	18	AFLPESFDGL	GGAGAGCTTTGATGGCCTCCCCCACTGGCA
ERBB2-CDK12	chr17	37868701	chr17	37680926	9	18	FLPESFDGL	GAGCTTTGATGGCCTCCCCCACTGGCA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of ERBB2-CDK12

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	ERBB2-CDK12	chr17	37868701	ENST00000269571	chr17	37680926	ENST00000430627	TCGA-BH-A204

Top

Potential target of CAR-T therapy development for ERBB2-CDK12

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ERBB2-CDK12

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ERBB2-CDK12

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)