Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ERBB2-CNIH4

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ERBB2-CNIH4
	FusionPDB ID: 27144
	FusionGDB2.0 ID: 27144
		Hgene	Tgene
	Gene symbol	ERBB2	CNIH4
	Gene ID	2064	29097
	Gene name	erb-b2 receptor tyrosine kinase 2	cornichon family AMPA receptor auxiliary protein 4
	Synonyms	CD340\|HER-2\|HER-2/neu\|HER2\|MLN 19\|NEU\|NGL\|TKR1	CNIH-4\|CNIH2\|HSPC163
	Cytomap	17q12	1q42.11
	Type of gene	protein-coding	protein-coding
	Description	receptor tyrosine-protein kinase erbB-2c-erb B2/neu proteinherstatinhuman epidermal growth factor receptor 2metastatic lymph node gene 19 proteinneuro/glioblastoma derived oncogene homologneuroblastoma/glioblastoma derived oncogene homologp185erbB2	protein cornichon homolog 4cornichon homolog 4
	Modification date	20200329	20200313
	UniProtAcc	P04626 Main function of 5'-partner protein: FUNCTION: Protein tyrosine kinase that is part of several cell surface receptor complexes, but that apparently needs a coreceptor for ligand binding. Essential component of a neuregulin-receptor complex, although neuregulins do not interact with it alone. GP30 is a potential ligand for this receptor. Regulates outgrowth and stabilization of peripheral microtubules (MTs). Upon ERBB2 activation, the MEMO1-RHOA-DIAPH1 signaling pathway elicits the phosphorylation and thus the inhibition of GSK3B at cell membrane. This prevents the phosphorylation of APC and CLASP2, allowing its association with the cell membrane. In turn, membrane-bound APC allows the localization of MACF1 to the cell membrane, which is required for microtubule capture and stabilization. {ECO:0000305}.; FUNCTION: In the nucleus is involved in transcriptional regulation. Associates with the 5'-TCAAATTC-3' sequence in the PTGS2/COX-2 promoter and activates its transcription. Implicated in transcriptional activation of CDKN1A; the function involves STAT3 and SRC. Involved in the transcription of rRNA genes by RNA Pol I and enhances protein synthesis and cell growth. {ECO:0000269\|PubMed:10358079, ECO:0000269\|PubMed:15380516, ECO:0000269\|PubMed:21555369}.	Q9P003 Main function of 5'-partner protein: FUNCTION: Involved in G protein-coupled receptors (GPCRs) trafficking from the endoplasmic reticulum to the cell surface; it promotes the exit of GPCRs from the early secretory pathway, likely through interaction with the COPII machinery (PubMed:24405750). {ECO:0000269\|PubMed:24405750}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000269571, ENST00000406381, ENST00000540042, ENST00000540147, ENST00000541774, ENST00000578199, ENST00000584450, ENST00000584601, ENST00000445658, ENST00000584888,	ENST00000366856, ENST00000468318, ENST00000366857, ENST00000366858, ENST00000465271,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	50 X 44 X 14=30800	10 X 7 X 8=560
	# samples	73	13
	** MAII score	log2(73/30800*10)=-5.39889007670225 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(13/560*10)=-2.10691520391651 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ERBB2 [Title/Abstract] AND CNIH4 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ERBB2 [Title/Abstract] AND CNIH4 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ERBB2(37866734)-CNIH4(224553581), # samples:2
Anticipated loss of major functional domain due to fusion event.	ERBB2-CNIH4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ERBB2-CNIH4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ERBB2-CNIH4 seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. ERBB2-CNIH4 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. ERBB2-CNIH4 seems lost the major protein functional domain in Hgene partner, which is a kinase due to the frame-shifted ORF. ERBB2-CNIH4 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	ERBB2	GO:0007165	signal transduction	10572067
Hgene	ERBB2	GO:0007166	cell surface receptor signaling pathway	9685399
Hgene	ERBB2	GO:0007169	transmembrane receptor protein tyrosine kinase signaling pathway	7514177
Hgene	ERBB2	GO:0014065	phosphatidylinositol 3-kinase signaling	7556068
Hgene	ERBB2	GO:0018108	peptidyl-tyrosine phosphorylation	12000754
Hgene	ERBB2	GO:0032886	regulation of microtubule-based process	20937854
Hgene	ERBB2	GO:0035556	intracellular signal transduction	19372587
Hgene	ERBB2	GO:0042060	wound healing	12646923
Hgene	ERBB2	GO:0043406	positive regulation of MAP kinase activity	10572067
Hgene	ERBB2	GO:0045785	positive regulation of cell adhesion	7556068
Hgene	ERBB2	GO:0046777	protein autophosphorylation	7556068
Hgene	ERBB2	GO:0050679	positive regulation of epithelial cell proliferation	10572067
Hgene	ERBB2	GO:0071363	cellular response to growth factor stimulus	20010870
Hgene	ERBB2	GO:0090314	positive regulation of protein targeting to membrane	20010870

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:37866734/chr1:224553581)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ERBB2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across CNIH4 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000584601	ERBB2	chr17	37863394	+	ENST00000465271	CNIH4	chr1	224553581	+	4844	932	752	1213	153
ENST00000584601	ERBB2	chr17	37863394	+	ENST00000366858	CNIH4	chr1	224553581	+	1429	932	703	1050	115
ENST00000584601	ERBB2	chr17	37863394	+	ENST00000366857	CNIH4	chr1	224553581	+	4703	932	703	1068	121
ENST00000406381	ERBB2	chr17	37863394	+	ENST00000465271	CNIH4	chr1	224553581	+	4557	645	510	926	138
ENST00000406381	ERBB2	chr17	37863394	+	ENST00000366858	CNIH4	chr1	224553581	+	1142	645	467	763	98
ENST00000406381	ERBB2	chr17	37863394	+	ENST00000366857	CNIH4	chr1	224553581	+	4416	645	467	781	104
ENST00000541774	ERBB2	chr17	37863394	+	ENST00000465271	CNIH4	chr1	224553581	+	4092	180	0	461	153
ENST00000541774	ERBB2	chr17	37863394	+	ENST00000366858	CNIH4	chr1	224553581	+	677	180	0	314	104
ENST00000541774	ERBB2	chr17	37863394	+	ENST00000366857	CNIH4	chr1	224553581	+	3951	180	0	320	106
ENST00000540147	ERBB2	chr17	37863394	+	ENST00000465271	CNIH4	chr1	224553581	+	4375	463	25	744	239
ENST00000540147	ERBB2	chr17	37863394	+	ENST00000366858	CNIH4	chr1	224553581	+	960	463	25	597	190
ENST00000540147	ERBB2	chr17	37863394	+	ENST00000366857	CNIH4	chr1	224553581	+	4234	463	25	603	192
ENST00000584450	ERBB2	chr17	37863394	+	ENST00000465271	CNIH4	chr1	224553581	+	4352	440	2	721	239
ENST00000584450	ERBB2	chr17	37863394	+	ENST00000366858	CNIH4	chr1	224553581	+	937	440	2	574	190
ENST00000584450	ERBB2	chr17	37863394	+	ENST00000366857	CNIH4	chr1	224553581	+	4211	440	2	580	192
ENST00000269571	ERBB2	chr17	37863394	+	ENST00000465271	CNIH4	chr1	224553581	+	4296	384	57	665	202
ENST00000269571	ERBB2	chr17	37863394	+	ENST00000366858	CNIH4	chr1	224553581	+	881	384	57	518	153
ENST00000269571	ERBB2	chr17	37863394	+	ENST00000366857	CNIH4	chr1	224553581	+	4155	384	57	524	155
ENST00000578199	ERBB2	chr17	37863394	+	ENST00000465271	CNIH4	chr1	224553581	+	4588	676	541	957	138
ENST00000578199	ERBB2	chr17	37863394	+	ENST00000366858	CNIH4	chr1	224553581	+	1173	676	498	794	98
ENST00000578199	ERBB2	chr17	37863394	+	ENST00000366857	CNIH4	chr1	224553581	+	4447	676	498	812	104
ENST00000540042	ERBB2	chr17	37863394	+	ENST00000465271	CNIH4	chr1	224553581	+	4213	301	166	582	138
ENST00000540042	ERBB2	chr17	37863394	+	ENST00000366858	CNIH4	chr1	224553581	+	798	301	144	419	91
ENST00000540042	ERBB2	chr17	37863394	+	ENST00000366857	CNIH4	chr1	224553581	+	4072	301	144	437	97

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000584601	ENST00000465271	ERBB2	chr17	37863394	+	CNIH4	chr1	224553581	+	0.057834342	0.9421657
ENST00000584601	ENST00000366858	ERBB2	chr17	37863394	+	CNIH4	chr1	224553581	+	0.13345093	0.866549
ENST00000584601	ENST00000366857	ERBB2	chr17	37863394	+	CNIH4	chr1	224553581	+	0.26847076	0.73152924
ENST00000406381	ENST00000465271	ERBB2	chr17	37863394	+	CNIH4	chr1	224553581	+	0.060717426	0.9392826
ENST00000406381	ENST00000366858	ERBB2	chr17	37863394	+	CNIH4	chr1	224553581	+	0.17339388	0.8266061
ENST00000406381	ENST00000366857	ERBB2	chr17	37863394	+	CNIH4	chr1	224553581	+	0.28449595	0.71550405
ENST00000541774	ENST00000465271	ERBB2	chr17	37863394	+	CNIH4	chr1	224553581	+	0.05642887	0.94357115
ENST00000541774	ENST00000366858	ERBB2	chr17	37863394	+	CNIH4	chr1	224553581	+	0.12919718	0.8708028
ENST00000541774	ENST00000366857	ERBB2	chr17	37863394	+	CNIH4	chr1	224553581	+	0.27613685	0.7238631
ENST00000540147	ENST00000465271	ERBB2	chr17	37863394	+	CNIH4	chr1	224553581	+	0.018296866	0.9817031
ENST00000540147	ENST00000366858	ERBB2	chr17	37863394	+	CNIH4	chr1	224553581	+	0.15582278	0.84417725
ENST00000540147	ENST00000366857	ERBB2	chr17	37863394	+	CNIH4	chr1	224553581	+	0.094604954	0.90539503
ENST00000584450	ENST00000465271	ERBB2	chr17	37863394	+	CNIH4	chr1	224553581	+	0.018018335	0.9819817
ENST00000584450	ENST00000366858	ERBB2	chr17	37863394	+	CNIH4	chr1	224553581	+	0.13191701	0.868083
ENST00000584450	ENST00000366857	ERBB2	chr17	37863394	+	CNIH4	chr1	224553581	+	0.09332618	0.90667385
ENST00000269571	ENST00000465271	ERBB2	chr17	37863394	+	CNIH4	chr1	224553581	+	0.017273726	0.9827262
ENST00000269571	ENST00000366858	ERBB2	chr17	37863394	+	CNIH4	chr1	224553581	+	0.08023406	0.9197659
ENST00000269571	ENST00000366857	ERBB2	chr17	37863394	+	CNIH4	chr1	224553581	+	0.09075072	0.90924925
ENST00000578199	ENST00000465271	ERBB2	chr17	37863394	+	CNIH4	chr1	224553581	+	0.060766924	0.93923306
ENST00000578199	ENST00000366858	ERBB2	chr17	37863394	+	CNIH4	chr1	224553581	+	0.28703627	0.71296376
ENST00000578199	ENST00000366857	ERBB2	chr17	37863394	+	CNIH4	chr1	224553581	+	0.29321608	0.70678395
ENST00000540042	ENST00000465271	ERBB2	chr17	37863394	+	CNIH4	chr1	224553581	+	0.064463556	0.93553644
ENST00000540042	ENST00000366858	ERBB2	chr17	37863394	+	CNIH4	chr1	224553581	+	0.22571121	0.77428883
ENST00000540042	ENST00000366857	ERBB2	chr17	37863394	+	CNIH4	chr1	224553581	+	0.32422227	0.67577773

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ERBB2-CNIH4

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ERBB2	chr17	37863394	CNIH4	chr1	224553581	180	58	ELTYLPTNASLSFLQWVIPELIGHTI
ERBB2	chr17	37863394	CNIH4	chr1	224553581	301	43	ELTYLPTNASLSFLQWVIPELIGHTI
ERBB2	chr17	37863394	CNIH4	chr1	224553581	301	51	THLPAHQCQPVLPAVGNSRIDWPYHC
ERBB2	chr17	37863394	CNIH4	chr1	224553581	384	107	ELTYLPTNASLSFLQWVIPELIGHTI
ERBB2	chr17	37863394	CNIH4	chr1	224553581	440	144	ELTYLPTNASLSFLQWVIPELIGHTI
ERBB2	chr17	37863394	CNIH4	chr1	224553581	463	144	ELTYLPTNASLSFLQWVIPELIGHTI
ERBB2	chr17	37863394	CNIH4	chr1	224553581	645	43	ELTYLPTNASLSFLQWVIPELIGHTI
ERBB2	chr17	37863394	CNIH4	chr1	224553581	645	58	THLPAHQCQPVLPAVGNSRIDWPYHC
ERBB2	chr17	37863394	CNIH4	chr1	224553581	676	43	ELTYLPTNASLSFLQWVIPELIGHTI
ERBB2	chr17	37863394	CNIH4	chr1	224553581	676	58	THLPAHQCQPVLPAVGNSRIDWPYHC
ERBB2	chr17	37863394	CNIH4	chr1	224553581	932	58	ELTYLPTNASLSFLQWVIPELIGHTI
ERBB2	chr17	37863394	CNIH4	chr1	224553581	932	75	THLPAHQCQPVLPAVGNSRIDWPYHC

Top

Potential FusionNeoAntigen Information of ERBB2-CNIH4 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ERBB2-CNIH4_37863394_224553581.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B57:01	ASLSFLQW	0.9998	0.9981	8	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B58:02	ASLSFLQW	0.999	0.995	8	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B58:01	ASLSFLQW	0.9982	0.9964	8	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B57:03	ASLSFLQW	0.9976	0.9992	8	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B58:01	NASLSFLQW	0.9985	0.9954	7	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B57:01	NASLSFLQW	0.9981	0.9974	7	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A02:22	FLQWVIPEL	0.997	0.7367	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B58:02	NASLSFLQW	0.9962	0.9963	7	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A02:67	FLQWVIPEL	0.9957	0.6733	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A02:30	FLQWVIPEL	0.9957	0.6733	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A02:24	FLQWVIPEL	0.9957	0.6733	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A02:60	FLQWVIPEL	0.9956	0.679	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A02:11	FLQWVIPEL	0.9955	0.7029	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B15:17	NASLSFLQW	0.9935	0.9738	7	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B15:16	NASLSFLQW	0.9931	0.9489	7	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A02:21	FLQWVIPEL	0.993	0.7879	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A02:27	FLQWVIPEL	0.9912	0.6423	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A02:04	FLQWVIPEL	0.9906	0.8226	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A02:16	FLQWVIPEL	0.9893	0.6751	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A02:17	FLQWVIPEL	0.9866	0.7266	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A02:13	FLQWVIPEL	0.9829	0.7415	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B53:01	NASLSFLQW	0.9813	0.842	7	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A02:35	FLQWVIPEL	0.9691	0.6846	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A02:21	ASLSFLQWV	0.9678	0.9305	8	17
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A02:19	FLQWVIPEL	0.965	0.5808	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B57:03	NASLSFLQW	0.9593	0.999	7	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A02:38	FLQWVIPEL	0.9559	0.6128	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A02:29	FLQWVIPEL	0.9445	0.6766	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A32:13	NASLSFLQW	0.9307	0.995	7	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	645	HLA-B39:06	HQCQPVLPA	0.9239	0.9498	5	14
ERBB2-CNIH4	chr17	37863394	chr1	224553581	645	HLA-B35:03	LPAVGNSRI	0.9179	0.7972	11	20
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A02:20	FLQWVIPEL	0.9031	0.6808	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	645	HLA-B35:04	LPAVGNSRI	0.8912	0.9539	11	20
ERBB2-CNIH4	chr17	37863394	chr1	224553581	645	HLA-B35:02	LPAVGNSRI	0.8912	0.9539	11	20
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B57:01	TNASLSFLQW	0.9997	0.9966	6	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B58:02	TNASLSFLQW	0.9983	0.9958	6	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B58:01	TNASLSFLQW	0.9977	0.9943	6	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	645	HLA-B39:06	AHQCQPVLPA	0.9964	0.9634	4	14
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B57:03	TNASLSFLQW	0.9929	0.9989	6	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B35:03	LPTNASLSFL	0.9849	0.7801	4	14
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B35:02	LPTNASLSFL	0.9504	0.874	4	14
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B35:04	LPTNASLSFL	0.9504	0.874	4	14
ERBB2-CNIH4	chr17	37863394	chr1	224553581	645	HLA-B13:02	HQCQPVLPAV	0.714	0.9795	5	15
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A02:02	FLQWVIPEL	0.997	0.6287	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A02:07	FLQWVIPEL	0.9957	0.7085	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A02:01	FLQWVIPEL	0.9957	0.6733	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A02:05	FLQWVIPEL	0.9942	0.7228	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C05:09	FLQWVIPEL	0.9844	0.9823	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	645	HLA-B78:01	LPAVGNSRI	0.9751	0.7043	11	20
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C03:07	FLQWVIPEL	0.9449	0.9941	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C03:19	FLQWVIPEL	0.8945	0.9959	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	645	HLA-B35:12	LPAVGNSRI	0.8912	0.9539	11	20
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C04:14	FLQWVIPEL	0.8883	0.8842	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C04:06	FLQWVIPEL	0.8879	0.9349	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C08:13	FLQWVIPEL	0.7959	0.9908	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C08:04	FLQWVIPEL	0.7959	0.9908	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C08:03	FLQWVIPEL	0.7831	0.9957	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C01:17	FLQWVIPEL	0.7823	0.9619	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	645	HLA-B15:04	HQCQPVLPA	0.7083	0.8551	5	14
ERBB2-CNIH4	chr17	37863394	chr1	224553581	645	HLA-B42:01	LPAVGNSRI	0.6697	0.6013	11	20
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C07:13	FLQWVIPEL	0.5482	0.9783	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C07:05	FLQWVIPEL	0.5383	0.9807	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C07:29	FLQWVIPEL	0.525	0.974	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C02:06	FLQWVIPEL	0.512	0.9925	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B44:08	NASLSFLQW	0.5029	0.7287	7	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C03:14	FLQWVIPEL	0.4977	0.9925	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C07:27	FLQWVIPEL	0.3462	0.9787	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C01:30	FLQWVIPEL	0.2344	0.9637	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	645	HLA-B39:10	LPAVGNSRI	0.2124	0.9538	11	20
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B35:12	LPTNASLSFL	0.9504	0.874	4	14
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B07:12	LPTNASLSFL	0.9111	0.5136	4	14
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B39:10	LPTNASLSFL	0.8477	0.8979	4	14
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B42:01	LPTNASLSFL	0.7801	0.792	4	14
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C01:17	YLPTNASLSFL	0.8868	0.9542	3	14
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C01:30	YLPTNASLSFL	0.8112	0.9566	3	14
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B57:10	ASLSFLQW	0.9998	0.9981	8	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B57:04	ASLSFLQW	0.9993	0.9668	8	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B58:06	ASLSFLQW	0.9984	0.9946	8	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B57:02	ASLSFLQW	0.9976	0.9929	8	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B57:04	NASLSFLQW	0.9983	0.9531	7	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C15:02	ASLSFLQWV	0.9983	0.9671	8	17
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B57:10	NASLSFLQW	0.9981	0.9974	7	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B58:06	NASLSFLQW	0.9942	0.9882	7	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A02:03	FLQWVIPEL	0.9937	0.8285	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A02:06	FLQWVIPEL	0.993	0.7879	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A02:14	FLQWVIPEL	0.9925	0.765	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B57:02	NASLSFLQW	0.9891	0.9948	7	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C04:03	FLQWVIPEL	0.9886	0.8847	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C05:01	FLQWVIPEL	0.9844	0.9823	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B15:13	NASLSFLQW	0.9831	0.8316	7	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	645	HLA-B78:02	LPAVGNSRI	0.9807	0.8081	11	20
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B53:02	NASLSFLQW	0.9705	0.8524	7	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A02:06	ASLSFLQWV	0.9678	0.9305	8	17
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C03:03	FLQWVIPEL	0.9533	0.995	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C03:04	FLQWVIPEL	0.9533	0.995	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C01:03	FLQWVIPEL	0.92	0.9456	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C03:67	FLQWVIPEL	0.902	0.9908	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C03:06	FLQWVIPEL	0.8975	0.9961	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	645	HLA-B35:09	LPAVGNSRI	0.8912	0.9539	11	20
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C03:05	FLQWVIPEL	0.8721	0.9687	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C04:04	FLQWVIPEL	0.8076	0.9354	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C01:02	FLQWVIPEL	0.8067	0.9604	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C08:01	FLQWVIPEL	0.7831	0.9957	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C07:04	FLQWVIPEL	0.6757	0.958	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C17:01	FLQWVIPEL	0.6641	0.9793	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-A25:01	NASLSFLQW	0.4264	0.9811	7	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	645	HLA-B67:01	LPAVGNSRI	0.4035	0.8622	11	20
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B51:06	NASLSFLQW	0.3728	0.9301	7	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B40:21	FLQWVIPEL	0.1989	0.5764	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B07:13	FLQWVIPEL	0.1405	0.8553	12	21
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B57:10	TNASLSFLQW	0.9997	0.9966	6	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B57:04	TNASLSFLQW	0.999	0.9373	6	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B57:02	TNASLSFLQW	0.9766	0.9953	6	16
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B35:09	LPTNASLSFL	0.9504	0.874	4	14
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-B67:01	LPTNASLSFL	0.8646	0.7192	4	14
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C01:03	YLPTNASLSFL	0.9453	0.945	3	14
ERBB2-CNIH4	chr17	37863394	chr1	224553581	384	HLA-C01:02	YLPTNASLSFL	0.8727	0.9519	3	14

Top

Potential FusionNeoAntigen Information of ERBB2-CNIH4 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of ERBB2-CNIH4

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7168	QCQPVLPAVGNSRI	ERBB2	CNIH4	chr17	37863394	chr1	224553581	645

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
9517	TNASLSFLQWVIPE	ERBB2	CNIH4	chr17	37863394	chr1	224553581	384

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ERBB2-CNIH4

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	7168	QCQPVLPAVGNSRI	-7.15543	-7.26883
HLA-B14:02	3BVN	7168	QCQPVLPAVGNSRI	-4.77435	-5.80965
HLA-B52:01	3W39	7168	QCQPVLPAVGNSRI	-6.80875	-6.92215
HLA-B52:01	3W39	7168	QCQPVLPAVGNSRI	-4.20386	-5.23916
HLA-A11:01	4UQ2	7168	QCQPVLPAVGNSRI	-7.5194	-8.5547
HLA-A11:01	4UQ2	7168	QCQPVLPAVGNSRI	-6.9601	-7.0735
HLA-A24:02	5HGA	7168	QCQPVLPAVGNSRI	-7.52403	-7.63743
HLA-A24:02	5HGA	7168	QCQPVLPAVGNSRI	-5.82433	-6.85963
HLA-B27:05	6PYJ	7168	QCQPVLPAVGNSRI	-3.28285	-4.31815
HLA-B44:05	3DX8	7168	QCQPVLPAVGNSRI	-5.91172	-6.94702
HLA-B44:05	3DX8	7168	QCQPVLPAVGNSRI	-4.24346	-4.35686
HLA-B14:02	3BVN	9517	TNASLSFLQWVIPE	-8.55667	-8.74867
HLA-B14:02	3BVN	9517	TNASLSFLQWVIPE	-3.49457	-4.25557
HLA-B52:01	3W39	9517	TNASLSFLQWVIPE	-7.26725	-7.45925
HLA-B52:01	3W39	9517	TNASLSFLQWVIPE	-4.01461	-4.77561
HLA-A24:02	5HGA	9517	TNASLSFLQWVIPE	-7.65911	-8.42011
HLA-A24:02	5HGA	9517	TNASLSFLQWVIPE	-7.10204	-7.29404
HLA-B44:05	3DX8	9517	TNASLSFLQWVIPE	-7.5556	-8.3166
HLA-B44:05	3DX8	9517	TNASLSFLQWVIPE	-2.76159	-2.95359

Top

Vaccine Design for the FusionNeoAntigens of ERBB2-CNIH4

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ERBB2-CNIH4	chr17	37863394	chr1	224553581	11	20	LPAVGNSRI	CTGCAGTGGGTAATTCCAGAATTGATT
ERBB2-CNIH4	chr17	37863394	chr1	224553581	12	21	FLQWVIPEL	CAGTGGGTAATTCCAGAATTGATTGGC
ERBB2-CNIH4	chr17	37863394	chr1	224553581	3	14	YLPTNASLSFL	CCCACCAATGCCAGCCTGTCCTTCCTGCAGTGG
ERBB2-CNIH4	chr17	37863394	chr1	224553581	4	14	AHQCQPVLPA	ACCAATGCCAGCCTGTCCTTCCTGCAGTGG
ERBB2-CNIH4	chr17	37863394	chr1	224553581	4	14	LPTNASLSFL	ACCAATGCCAGCCTGTCCTTCCTGCAGTGG
ERBB2-CNIH4	chr17	37863394	chr1	224553581	5	14	HQCQPVLPA	AATGCCAGCCTGTCCTTCCTGCAGTGG
ERBB2-CNIH4	chr17	37863394	chr1	224553581	5	15	HQCQPVLPAV	AATGCCAGCCTGTCCTTCCTGCAGTGGGTA
ERBB2-CNIH4	chr17	37863394	chr1	224553581	6	16	TNASLSFLQW	GCCAGCCTGTCCTTCCTGCAGTGGGTAATT
ERBB2-CNIH4	chr17	37863394	chr1	224553581	7	16	NASLSFLQW	AGCCTGTCCTTCCTGCAGTGGGTAATT
ERBB2-CNIH4	chr17	37863394	chr1	224553581	8	16	ASLSFLQW	CTGTCCTTCCTGCAGTGGGTAATT
ERBB2-CNIH4	chr17	37863394	chr1	224553581	8	17	ASLSFLQWV	CTGTCCTTCCTGCAGTGGGTAATTCCA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of ERBB2-CNIH4

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
UCEC	ERBB2-CNIH4	chr17	37863394	ENST00000269571	chr1	224553581	ENST00000366857	TCGA-D1-A3JP-01A
UCEC	ERBB2-CNIH4	chr17	37863394	ENST00000406381	chr1	224553581	ENST00000366857	TCGA-D1-A3JP-01A

Top

Potential target of CAR-T therapy development for ERBB2-CNIH4

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Tgene

CNIH4

chr17:37863394

chr1:224553581

ENST00000366857

118_138

93.0

Transmembrane

Helical

Tgene

CNIH4

chr17:37863394

chr1:224553581

ENST00000366857

57_77

93.0

Transmembrane

Helical

Tgene

CNIH4

chr17:37863394

chr1:224553581

ENST00000465271

118_138

140.0

Transmembrane

Helical

Tgene

CNIH4

chr17:37863394

chr1:224553581

ENST00000465271

57_77

140.0

Transmembrane

Helical

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ERBB2-CNIH4

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ERBB2-CNIH4

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)