Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ERBB2-EIF1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ERBB2-EIF1
	FusionPDB ID: 27147
	FusionGDB2.0 ID: 27147
		Hgene	Tgene
	Gene symbol	ERBB2	EIF1
	Gene ID	2064	10209
	Gene name	erb-b2 receptor tyrosine kinase 2	eukaryotic translation initiation factor 1
	Synonyms	CD340\|HER-2\|HER-2/neu\|HER2\|MLN 19\|NEU\|NGL\|TKR1	A121\|EIF-1\|EIF1A\|ISO1\|SUI1
	Cytomap	17q12	17q21.2
	Type of gene	protein-coding	protein-coding
	Description	receptor tyrosine-protein kinase erbB-2c-erb B2/neu proteinherstatinhuman epidermal growth factor receptor 2metastatic lymph node gene 19 proteinneuro/glioblastoma derived oncogene homologneuroblastoma/glioblastoma derived oncogene homologp185erbB2	eukaryotic translation initiation factor 1protein translation factor SUI1 homologsui1iso1
	Modification date	20200329	20200313
	UniProtAcc	P04626 Main function of 5'-partner protein: FUNCTION: Protein tyrosine kinase that is part of several cell surface receptor complexes, but that apparently needs a coreceptor for ligand binding. Essential component of a neuregulin-receptor complex, although neuregulins do not interact with it alone. GP30 is a potential ligand for this receptor. Regulates outgrowth and stabilization of peripheral microtubules (MTs). Upon ERBB2 activation, the MEMO1-RHOA-DIAPH1 signaling pathway elicits the phosphorylation and thus the inhibition of GSK3B at cell membrane. This prevents the phosphorylation of APC and CLASP2, allowing its association with the cell membrane. In turn, membrane-bound APC allows the localization of MACF1 to the cell membrane, which is required for microtubule capture and stabilization. {ECO:0000305}.; FUNCTION: In the nucleus is involved in transcriptional regulation. Associates with the 5'-TCAAATTC-3' sequence in the PTGS2/COX-2 promoter and activates its transcription. Implicated in transcriptional activation of CDKN1A; the function involves STAT3 and SRC. Involved in the transcription of rRNA genes by RNA Pol I and enhances protein synthesis and cell growth. {ECO:0000269\|PubMed:10358079, ECO:0000269\|PubMed:15380516, ECO:0000269\|PubMed:21555369}.	O60739 Main function of 5'-partner protein: FUNCTION: Probably involved in translation.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000269571, ENST00000406381, ENST00000445658, ENST00000540042, ENST00000540147, ENST00000541774, ENST00000578199, ENST00000584450, ENST00000584601, ENST00000584888,	ENST00000310837, ENST00000469257, ENST00000591776,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	50 X 44 X 14=30800	16 X 13 X 8=1664
	# samples	73	17
	** MAII score	log2(73/30800*10)=-5.39889007670225 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(17/1664*10)=-3.29104878200339 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ERBB2 [Title/Abstract] AND EIF1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ERBB2 [Title/Abstract] AND EIF1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ERBB2(37868701)-EIF1(39846029), # samples:1 ERBB2(37868300)-EIF1(39846029), # samples:1 ERBB2(37868701)-EIF1(39846030), # samples:1
Anticipated loss of major functional domain due to fusion event.	ERBB2-EIF1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ERBB2-EIF1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ERBB2-EIF1 seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. ERBB2-EIF1 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. ERBB2-EIF1 seems lost the major protein functional domain in Hgene partner, which is a kinase due to the frame-shifted ORF. ERBB2-EIF1 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	ERBB2	GO:0007165	signal transduction	10572067
Hgene	ERBB2	GO:0007166	cell surface receptor signaling pathway	9685399
Hgene	ERBB2	GO:0007169	transmembrane receptor protein tyrosine kinase signaling pathway	7514177
Hgene	ERBB2	GO:0014065	phosphatidylinositol 3-kinase signaling	7556068
Hgene	ERBB2	GO:0018108	peptidyl-tyrosine phosphorylation	12000754
Hgene	ERBB2	GO:0032886	regulation of microtubule-based process	20937854
Hgene	ERBB2	GO:0035556	intracellular signal transduction	19372587
Hgene	ERBB2	GO:0042060	wound healing	12646923
Hgene	ERBB2	GO:0043406	positive regulation of MAP kinase activity	10572067
Hgene	ERBB2	GO:0045785	positive regulation of cell adhesion	7556068
Hgene	ERBB2	GO:0046777	protein autophosphorylation	7556068
Hgene	ERBB2	GO:0050679	positive regulation of epithelial cell proliferation	10572067
Hgene	ERBB2	GO:0071363	cellular response to growth factor stimulus	20010870
Hgene	ERBB2	GO:0090314	positive regulation of protein targeting to membrane	20010870
Tgene	EIF1	GO:0006446	regulation of translational initiation	22156057

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:37868701/chr17:39846029)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ERBB2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across EIF1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000584601	ERBB2	chr17	37868300	+	ENST00000591776	EIF1	chr17	39846029	+	2342	1728	752	2062	436
ENST00000584601	ERBB2	chr17	37868300	+	ENST00000469257	EIF1	chr17	39846029	+	3881	1728	752	2038	428
ENST00000406381	ERBB2	chr17	37868300	+	ENST00000591776	EIF1	chr17	39846029	+	2055	1441	510	1775	421
ENST00000406381	ERBB2	chr17	37868300	+	ENST00000469257	EIF1	chr17	39846029	+	3594	1441	510	1751	413
ENST00000541774	ERBB2	chr17	37868300	+	ENST00000591776	EIF1	chr17	39846029	+	1590	976	0	1310	436
ENST00000541774	ERBB2	chr17	37868300	+	ENST00000469257	EIF1	chr17	39846029	+	3129	976	0	1286	428
ENST00000445658	ERBB2	chr17	37868300	+	ENST00000591776	EIF1	chr17	39846029	+	1070	456	50	790	246
ENST00000445658	ERBB2	chr17	37868300	+	ENST00000469257	EIF1	chr17	39846029	+	2609	456	50	766	238
ENST00000540147	ERBB2	chr17	37868300	+	ENST00000591776	EIF1	chr17	39846029	+	1873	1259	25	1593	522
ENST00000540147	ERBB2	chr17	37868300	+	ENST00000469257	EIF1	chr17	39846029	+	3412	1259	25	1569	514
ENST00000584450	ERBB2	chr17	37868300	+	ENST00000591776	EIF1	chr17	39846029	+	1850	1236	2	1570	522
ENST00000584450	ERBB2	chr17	37868300	+	ENST00000469257	EIF1	chr17	39846029	+	3389	1236	2	1546	514
ENST00000269571	ERBB2	chr17	37868300	+	ENST00000591776	EIF1	chr17	39846029	+	1794	1180	57	1514	485
ENST00000269571	ERBB2	chr17	37868300	+	ENST00000469257	EIF1	chr17	39846029	+	3333	1180	57	1490	477
ENST00000578199	ERBB2	chr17	37868300	+	ENST00000591776	EIF1	chr17	39846029	+	2086	1472	541	1806	421
ENST00000578199	ERBB2	chr17	37868300	+	ENST00000469257	EIF1	chr17	39846029	+	3625	1472	541	1782	413
ENST00000540042	ERBB2	chr17	37868300	+	ENST00000591776	EIF1	chr17	39846029	+	1711	1097	166	1431	421
ENST00000540042	ERBB2	chr17	37868300	+	ENST00000469257	EIF1	chr17	39846029	+	3250	1097	166	1407	413

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000584601	ENST00000591776	ERBB2	chr17	37868300	+	EIF1	chr17	39846029	+	0.009547677	0.9904523
ENST00000584601	ENST00000469257	ERBB2	chr17	37868300	+	EIF1	chr17	39846029	+	0.004325743	0.9956742
ENST00000406381	ENST00000591776	ERBB2	chr17	37868300	+	EIF1	chr17	39846029	+	0.005476336	0.99452364
ENST00000406381	ENST00000469257	ERBB2	chr17	37868300	+	EIF1	chr17	39846029	+	0.001978484	0.9980215
ENST00000541774	ENST00000591776	ERBB2	chr17	37868300	+	EIF1	chr17	39846029	+	0.012362422	0.9876375
ENST00000541774	ENST00000469257	ERBB2	chr17	37868300	+	EIF1	chr17	39846029	+	0.004036467	0.99596345
ENST00000445658	ENST00000591776	ERBB2	chr17	37868300	+	EIF1	chr17	39846029	+	0.009737628	0.9902624
ENST00000445658	ENST00000469257	ERBB2	chr17	37868300	+	EIF1	chr17	39846029	+	0.009048685	0.9909513
ENST00000540147	ENST00000591776	ERBB2	chr17	37868300	+	EIF1	chr17	39846029	+	0.01854586	0.98145413
ENST00000540147	ENST00000469257	ERBB2	chr17	37868300	+	EIF1	chr17	39846029	+	0.007078851	0.9929212
ENST00000584450	ENST00000591776	ERBB2	chr17	37868300	+	EIF1	chr17	39846029	+	0.019969618	0.98003036
ENST00000584450	ENST00000469257	ERBB2	chr17	37868300	+	EIF1	chr17	39846029	+	0.00733398	0.99266607
ENST00000269571	ENST00000591776	ERBB2	chr17	37868300	+	EIF1	chr17	39846029	+	0.0197575	0.98024255
ENST00000269571	ENST00000469257	ERBB2	chr17	37868300	+	EIF1	chr17	39846029	+	0.007189651	0.99281037
ENST00000578199	ENST00000591776	ERBB2	chr17	37868300	+	EIF1	chr17	39846029	+	0.004093571	0.99590635
ENST00000578199	ENST00000469257	ERBB2	chr17	37868300	+	EIF1	chr17	39846029	+	0.001662781	0.99833715
ENST00000540042	ENST00000591776	ERBB2	chr17	37868300	+	EIF1	chr17	39846029	+	0.005486014	0.994514
ENST00000540042	ENST00000469257	ERBB2	chr17	37868300	+	EIF1	chr17	39846029	+	0.001738372	0.99826163

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ERBB2-EIF1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ERBB2	chr17	37868300	EIF1	chr17	39846029	1097	310	TQRCEKCSKPCARDPFADASKGDDLL
ERBB2	chr17	37868300	EIF1	chr17	39846029	1180	374	TQRCEKCSKPCARDPFADASKGDDLL
ERBB2	chr17	37868300	EIF1	chr17	39846029	1236	411	TQRCEKCSKPCARDPFADASKGDDLL
ERBB2	chr17	37868300	EIF1	chr17	39846029	1259	411	TQRCEKCSKPCARDPFADASKGDDLL
ERBB2	chr17	37868300	EIF1	chr17	39846029	1441	310	TQRCEKCSKPCARDPFADASKGDDLL
ERBB2	chr17	37868300	EIF1	chr17	39846029	1472	310	TQRCEKCSKPCARDPFADASKGDDLL
ERBB2	chr17	37868300	EIF1	chr17	39846029	1728	325	TQRCEKCSKPCARDPFADASKGDDLL
ERBB2	chr17	37868300	EIF1	chr17	39846029	456	135	TQRCEKCSKPCARDPFADASKGDDLL
ERBB2	chr17	37868300	EIF1	chr17	39846029	976	325	TQRCEKCSKPCARDPFADASKGDDLL

Top

Potential FusionNeoAntigen Information of ERBB2-EIF1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ERBB2-EIF1_37868300_39846029.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ERBB2-EIF1	chr17	37868300	chr17	39846029	1180	HLA-B27:14	ARDPFADASK	0.9931	0.5848	11	21

Top

Potential FusionNeoAntigen Information of ERBB2-EIF1 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of ERBB2-EIF1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
936	CSKPCARDPFADAS	ERBB2	EIF1	chr17	37868300	chr17	39846029	1180

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ERBB2-EIF1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	936	CSKPCARDPFADAS	-5.49577	-5.60917
HLA-B14:02	3BVN	936	CSKPCARDPFADAS	-4.37152	-5.40682
HLA-B52:01	3W39	936	CSKPCARDPFADAS	-6.90336	-7.01676
HLA-B52:01	3W39	936	CSKPCARDPFADAS	-4.80833	-5.84363
HLA-A11:01	4UQ2	936	CSKPCARDPFADAS	-9.82261	-9.93601
HLA-A24:02	5HGA	936	CSKPCARDPFADAS	-9.78612	-9.89952
HLA-A24:02	5HGA	936	CSKPCARDPFADAS	-4.98992	-6.02522
HLA-B27:05	6PYJ	936	CSKPCARDPFADAS	-5.31553	-6.35083
HLA-B44:05	3DX8	936	CSKPCARDPFADAS	-5.70582	-5.81922
HLA-B44:05	3DX8	936	CSKPCARDPFADAS	-4.32241	-5.35771

Top

Vaccine Design for the FusionNeoAntigens of ERBB2-EIF1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ERBB2-EIF1	chr17	37868300	chr17	39846029	11	21	ARDPFADASK	CCCGAGACCCCTTTGCTGATGCAAGTAAGG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of ERBB2-EIF1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	ERBB2-EIF1	chr17	37868300	ENST00000269571	chr17	39846029	ENST00000469257	TCGA-BR-A4PE

Top

Potential target of CAR-T therapy development for ERBB2-EIF1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ERBB2-EIF1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ERBB2-EIF1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)