![]() |
|||||||
|
Fusion Protein:ERBB2-EIF1 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: ERBB2-EIF1 | FusionPDB ID: 27147 | FusionGDB2.0 ID: 27147 | Hgene | Tgene | Gene symbol | ERBB2 | EIF1 | Gene ID | 2064 | 10209 |
Gene name | erb-b2 receptor tyrosine kinase 2 | eukaryotic translation initiation factor 1 | |
Synonyms | CD340|HER-2|HER-2/neu|HER2|MLN 19|NEU|NGL|TKR1 | A121|EIF-1|EIF1A|ISO1|SUI1 | |
Cytomap | 17q12 | 17q21.2 | |
Type of gene | protein-coding | protein-coding | |
Description | receptor tyrosine-protein kinase erbB-2c-erb B2/neu proteinherstatinhuman epidermal growth factor receptor 2metastatic lymph node gene 19 proteinneuro/glioblastoma derived oncogene homologneuroblastoma/glioblastoma derived oncogene homologp185erbB2 | eukaryotic translation initiation factor 1protein translation factor SUI1 homologsui1iso1 | |
Modification date | 20200329 | 20200313 | |
UniProtAcc | P04626 Main function of 5'-partner protein: FUNCTION: Protein tyrosine kinase that is part of several cell surface receptor complexes, but that apparently needs a coreceptor for ligand binding. Essential component of a neuregulin-receptor complex, although neuregulins do not interact with it alone. GP30 is a potential ligand for this receptor. Regulates outgrowth and stabilization of peripheral microtubules (MTs). Upon ERBB2 activation, the MEMO1-RHOA-DIAPH1 signaling pathway elicits the phosphorylation and thus the inhibition of GSK3B at cell membrane. This prevents the phosphorylation of APC and CLASP2, allowing its association with the cell membrane. In turn, membrane-bound APC allows the localization of MACF1 to the cell membrane, which is required for microtubule capture and stabilization. {ECO:0000305}.; FUNCTION: In the nucleus is involved in transcriptional regulation. Associates with the 5'-TCAAATTC-3' sequence in the PTGS2/COX-2 promoter and activates its transcription. Implicated in transcriptional activation of CDKN1A; the function involves STAT3 and SRC. Involved in the transcription of rRNA genes by RNA Pol I and enhances protein synthesis and cell growth. {ECO:0000269|PubMed:10358079, ECO:0000269|PubMed:15380516, ECO:0000269|PubMed:21555369}. | O60739 Main function of 5'-partner protein: FUNCTION: Probably involved in translation. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000269571, ENST00000406381, ENST00000445658, ENST00000540042, ENST00000540147, ENST00000541774, ENST00000578199, ENST00000584450, ENST00000584601, ENST00000584888, | ENST00000310837, ENST00000469257, ENST00000591776, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 50 X 44 X 14=30800 | 16 X 13 X 8=1664 |
# samples | 73 | 17 | |
** MAII score | log2(73/30800*10)=-5.39889007670225 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(17/1664*10)=-3.29104878200339 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: ERBB2 [Title/Abstract] AND EIF1 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: ERBB2 [Title/Abstract] AND EIF1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | ERBB2(37868701)-EIF1(39846029), # samples:1 ERBB2(37868300)-EIF1(39846029), # samples:1 ERBB2(37868701)-EIF1(39846030), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | ERBB2-EIF1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ERBB2-EIF1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ERBB2-EIF1 seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. ERBB2-EIF1 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. ERBB2-EIF1 seems lost the major protein functional domain in Hgene partner, which is a kinase due to the frame-shifted ORF. ERBB2-EIF1 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | ERBB2 | GO:0007165 | signal transduction | 10572067 |
Hgene | ERBB2 | GO:0007166 | cell surface receptor signaling pathway | 9685399 |
Hgene | ERBB2 | GO:0007169 | transmembrane receptor protein tyrosine kinase signaling pathway | 7514177 |
Hgene | ERBB2 | GO:0014065 | phosphatidylinositol 3-kinase signaling | 7556068 |
Hgene | ERBB2 | GO:0018108 | peptidyl-tyrosine phosphorylation | 12000754 |
Hgene | ERBB2 | GO:0032886 | regulation of microtubule-based process | 20937854 |
Hgene | ERBB2 | GO:0035556 | intracellular signal transduction | 19372587 |
Hgene | ERBB2 | GO:0042060 | wound healing | 12646923 |
Hgene | ERBB2 | GO:0043406 | positive regulation of MAP kinase activity | 10572067 |
Hgene | ERBB2 | GO:0045785 | positive regulation of cell adhesion | 7556068 |
Hgene | ERBB2 | GO:0046777 | protein autophosphorylation | 7556068 |
Hgene | ERBB2 | GO:0050679 | positive regulation of epithelial cell proliferation | 10572067 |
Hgene | ERBB2 | GO:0071363 | cellular response to growth factor stimulus | 20010870 |
Hgene | ERBB2 | GO:0090314 | positive regulation of protein targeting to membrane | 20010870 |
Tgene | EIF1 | GO:0006446 | regulation of translational initiation | 22156057 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:37868701/chr17:39846029) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000584601 | ERBB2 | chr17 | 37868300 | + | ENST00000591776 | EIF1 | chr17 | 39846029 | + | 2342 | 1728 | 752 | 2062 | 436 |
ENST00000584601 | ERBB2 | chr17 | 37868300 | + | ENST00000469257 | EIF1 | chr17 | 39846029 | + | 3881 | 1728 | 752 | 2038 | 428 |
ENST00000406381 | ERBB2 | chr17 | 37868300 | + | ENST00000591776 | EIF1 | chr17 | 39846029 | + | 2055 | 1441 | 510 | 1775 | 421 |
ENST00000406381 | ERBB2 | chr17 | 37868300 | + | ENST00000469257 | EIF1 | chr17 | 39846029 | + | 3594 | 1441 | 510 | 1751 | 413 |
ENST00000541774 | ERBB2 | chr17 | 37868300 | + | ENST00000591776 | EIF1 | chr17 | 39846029 | + | 1590 | 976 | 0 | 1310 | 436 |
ENST00000541774 | ERBB2 | chr17 | 37868300 | + | ENST00000469257 | EIF1 | chr17 | 39846029 | + | 3129 | 976 | 0 | 1286 | 428 |
ENST00000445658 | ERBB2 | chr17 | 37868300 | + | ENST00000591776 | EIF1 | chr17 | 39846029 | + | 1070 | 456 | 50 | 790 | 246 |
ENST00000445658 | ERBB2 | chr17 | 37868300 | + | ENST00000469257 | EIF1 | chr17 | 39846029 | + | 2609 | 456 | 50 | 766 | 238 |
ENST00000540147 | ERBB2 | chr17 | 37868300 | + | ENST00000591776 | EIF1 | chr17 | 39846029 | + | 1873 | 1259 | 25 | 1593 | 522 |
ENST00000540147 | ERBB2 | chr17 | 37868300 | + | ENST00000469257 | EIF1 | chr17 | 39846029 | + | 3412 | 1259 | 25 | 1569 | 514 |
ENST00000584450 | ERBB2 | chr17 | 37868300 | + | ENST00000591776 | EIF1 | chr17 | 39846029 | + | 1850 | 1236 | 2 | 1570 | 522 |
ENST00000584450 | ERBB2 | chr17 | 37868300 | + | ENST00000469257 | EIF1 | chr17 | 39846029 | + | 3389 | 1236 | 2 | 1546 | 514 |
ENST00000269571 | ERBB2 | chr17 | 37868300 | + | ENST00000591776 | EIF1 | chr17 | 39846029 | + | 1794 | 1180 | 57 | 1514 | 485 |
ENST00000269571 | ERBB2 | chr17 | 37868300 | + | ENST00000469257 | EIF1 | chr17 | 39846029 | + | 3333 | 1180 | 57 | 1490 | 477 |
ENST00000578199 | ERBB2 | chr17 | 37868300 | + | ENST00000591776 | EIF1 | chr17 | 39846029 | + | 2086 | 1472 | 541 | 1806 | 421 |
ENST00000578199 | ERBB2 | chr17 | 37868300 | + | ENST00000469257 | EIF1 | chr17 | 39846029 | + | 3625 | 1472 | 541 | 1782 | 413 |
ENST00000540042 | ERBB2 | chr17 | 37868300 | + | ENST00000591776 | EIF1 | chr17 | 39846029 | + | 1711 | 1097 | 166 | 1431 | 421 |
ENST00000540042 | ERBB2 | chr17 | 37868300 | + | ENST00000469257 | EIF1 | chr17 | 39846029 | + | 3250 | 1097 | 166 | 1407 | 413 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000584601 | ENST00000591776 | ERBB2 | chr17 | 37868300 | + | EIF1 | chr17 | 39846029 | + | 0.009547677 | 0.9904523 |
ENST00000584601 | ENST00000469257 | ERBB2 | chr17 | 37868300 | + | EIF1 | chr17 | 39846029 | + | 0.004325743 | 0.9956742 |
ENST00000406381 | ENST00000591776 | ERBB2 | chr17 | 37868300 | + | EIF1 | chr17 | 39846029 | + | 0.005476336 | 0.99452364 |
ENST00000406381 | ENST00000469257 | ERBB2 | chr17 | 37868300 | + | EIF1 | chr17 | 39846029 | + | 0.001978484 | 0.9980215 |
ENST00000541774 | ENST00000591776 | ERBB2 | chr17 | 37868300 | + | EIF1 | chr17 | 39846029 | + | 0.012362422 | 0.9876375 |
ENST00000541774 | ENST00000469257 | ERBB2 | chr17 | 37868300 | + | EIF1 | chr17 | 39846029 | + | 0.004036467 | 0.99596345 |
ENST00000445658 | ENST00000591776 | ERBB2 | chr17 | 37868300 | + | EIF1 | chr17 | 39846029 | + | 0.009737628 | 0.9902624 |
ENST00000445658 | ENST00000469257 | ERBB2 | chr17 | 37868300 | + | EIF1 | chr17 | 39846029 | + | 0.009048685 | 0.9909513 |
ENST00000540147 | ENST00000591776 | ERBB2 | chr17 | 37868300 | + | EIF1 | chr17 | 39846029 | + | 0.01854586 | 0.98145413 |
ENST00000540147 | ENST00000469257 | ERBB2 | chr17 | 37868300 | + | EIF1 | chr17 | 39846029 | + | 0.007078851 | 0.9929212 |
ENST00000584450 | ENST00000591776 | ERBB2 | chr17 | 37868300 | + | EIF1 | chr17 | 39846029 | + | 0.019969618 | 0.98003036 |
ENST00000584450 | ENST00000469257 | ERBB2 | chr17 | 37868300 | + | EIF1 | chr17 | 39846029 | + | 0.00733398 | 0.99266607 |
ENST00000269571 | ENST00000591776 | ERBB2 | chr17 | 37868300 | + | EIF1 | chr17 | 39846029 | + | 0.0197575 | 0.98024255 |
ENST00000269571 | ENST00000469257 | ERBB2 | chr17 | 37868300 | + | EIF1 | chr17 | 39846029 | + | 0.007189651 | 0.99281037 |
ENST00000578199 | ENST00000591776 | ERBB2 | chr17 | 37868300 | + | EIF1 | chr17 | 39846029 | + | 0.004093571 | 0.99590635 |
ENST00000578199 | ENST00000469257 | ERBB2 | chr17 | 37868300 | + | EIF1 | chr17 | 39846029 | + | 0.001662781 | 0.99833715 |
ENST00000540042 | ENST00000591776 | ERBB2 | chr17 | 37868300 | + | EIF1 | chr17 | 39846029 | + | 0.005486014 | 0.994514 |
ENST00000540042 | ENST00000469257 | ERBB2 | chr17 | 37868300 | + | EIF1 | chr17 | 39846029 | + | 0.001738372 | 0.99826163 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for ERBB2-EIF1 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
ERBB2 | chr17 | 37868300 | EIF1 | chr17 | 39846029 | 1097 | 310 | TQRCEKCSKPCARDPFADASKGDDLL |
ERBB2 | chr17 | 37868300 | EIF1 | chr17 | 39846029 | 1180 | 374 | TQRCEKCSKPCARDPFADASKGDDLL |
ERBB2 | chr17 | 37868300 | EIF1 | chr17 | 39846029 | 1236 | 411 | TQRCEKCSKPCARDPFADASKGDDLL |
ERBB2 | chr17 | 37868300 | EIF1 | chr17 | 39846029 | 1259 | 411 | TQRCEKCSKPCARDPFADASKGDDLL |
ERBB2 | chr17 | 37868300 | EIF1 | chr17 | 39846029 | 1441 | 310 | TQRCEKCSKPCARDPFADASKGDDLL |
ERBB2 | chr17 | 37868300 | EIF1 | chr17 | 39846029 | 1472 | 310 | TQRCEKCSKPCARDPFADASKGDDLL |
ERBB2 | chr17 | 37868300 | EIF1 | chr17 | 39846029 | 1728 | 325 | TQRCEKCSKPCARDPFADASKGDDLL |
ERBB2 | chr17 | 37868300 | EIF1 | chr17 | 39846029 | 456 | 135 | TQRCEKCSKPCARDPFADASKGDDLL |
ERBB2 | chr17 | 37868300 | EIF1 | chr17 | 39846029 | 976 | 325 | TQRCEKCSKPCARDPFADASKGDDLL |
Top |
Potential FusionNeoAntigen Information of ERBB2-EIF1 in HLA I |
![]() |
ERBB2-EIF1_37868300_39846029.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
ERBB2-EIF1 | chr17 | 37868300 | chr17 | 39846029 | 1180 | HLA-B27:14 | ARDPFADASK | 0.9931 | 0.5848 | 11 | 21 |
Top |
Potential FusionNeoAntigen Information of ERBB2-EIF1 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of ERBB2-EIF1 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
936 | CSKPCARDPFADAS | ERBB2 | EIF1 | chr17 | 37868300 | chr17 | 39846029 | 1180 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ERBB2-EIF1 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 936 | CSKPCARDPFADAS | -5.49577 | -5.60917 |
HLA-B14:02 | 3BVN | 936 | CSKPCARDPFADAS | -4.37152 | -5.40682 |
HLA-B52:01 | 3W39 | 936 | CSKPCARDPFADAS | -6.90336 | -7.01676 |
HLA-B52:01 | 3W39 | 936 | CSKPCARDPFADAS | -4.80833 | -5.84363 |
HLA-A11:01 | 4UQ2 | 936 | CSKPCARDPFADAS | -9.82261 | -9.93601 |
HLA-A24:02 | 5HGA | 936 | CSKPCARDPFADAS | -9.78612 | -9.89952 |
HLA-A24:02 | 5HGA | 936 | CSKPCARDPFADAS | -4.98992 | -6.02522 |
HLA-B27:05 | 6PYJ | 936 | CSKPCARDPFADAS | -5.31553 | -6.35083 |
HLA-B44:05 | 3DX8 | 936 | CSKPCARDPFADAS | -5.70582 | -5.81922 |
HLA-B44:05 | 3DX8 | 936 | CSKPCARDPFADAS | -4.32241 | -5.35771 |
Top |
Vaccine Design for the FusionNeoAntigens of ERBB2-EIF1 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
ERBB2-EIF1 | chr17 | 37868300 | chr17 | 39846029 | 11 | 21 | ARDPFADASK | CCCGAGACCCCTTTGCTGATGCAAGTAAGG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of ERBB2-EIF1 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
STAD | ERBB2-EIF1 | chr17 | 37868300 | ENST00000269571 | chr17 | 39846029 | ENST00000469257 | TCGA-BR-A4PE |
Top |
Potential target of CAR-T therapy development for ERBB2-EIF1 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to ERBB2-EIF1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to ERBB2-EIF1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |