Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ERBB2-FKBP10

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ERBB2-FKBP10
	FusionPDB ID: 27148
	FusionGDB2.0 ID: 27148
		Hgene	Tgene
	Gene symbol	ERBB2	FKBP10
	Gene ID	2064	60681
	Gene name	erb-b2 receptor tyrosine kinase 2	FKBP prolyl isomerase 10
	Synonyms	CD340\|HER-2\|HER-2/neu\|HER2\|MLN 19\|NEU\|NGL\|TKR1	BRKS1\|FKBP65\|OI11\|OI6\|PPIASE\|hFKBP65
	Cytomap	17q12	17q21.2
	Type of gene	protein-coding	protein-coding
	Description	receptor tyrosine-protein kinase erbB-2c-erb B2/neu proteinherstatinhuman epidermal growth factor receptor 2metastatic lymph node gene 19 proteinneuro/glioblastoma derived oncogene homologneuroblastoma/glioblastoma derived oncogene homologp185erbB2	peptidyl-prolyl cis-trans isomerase FKBP1065 kDa FK506-binding protein65 kDa FKBPFK506 binding protein 10, 65 kDaFK506-binding protein 10FKBP-10FKBP-65PPIase FKBP10immunophilin FKBP65rotamase
	Modification date	20200329	20200313
	UniProtAcc	P04626 Main function of 5'-partner protein: FUNCTION: Protein tyrosine kinase that is part of several cell surface receptor complexes, but that apparently needs a coreceptor for ligand binding. Essential component of a neuregulin-receptor complex, although neuregulins do not interact with it alone. GP30 is a potential ligand for this receptor. Regulates outgrowth and stabilization of peripheral microtubules (MTs). Upon ERBB2 activation, the MEMO1-RHOA-DIAPH1 signaling pathway elicits the phosphorylation and thus the inhibition of GSK3B at cell membrane. This prevents the phosphorylation of APC and CLASP2, allowing its association with the cell membrane. In turn, membrane-bound APC allows the localization of MACF1 to the cell membrane, which is required for microtubule capture and stabilization. {ECO:0000305}.; FUNCTION: In the nucleus is involved in transcriptional regulation. Associates with the 5'-TCAAATTC-3' sequence in the PTGS2/COX-2 promoter and activates its transcription. Implicated in transcriptional activation of CDKN1A; the function involves STAT3 and SRC. Involved in the transcription of rRNA genes by RNA Pol I and enhances protein synthesis and cell growth. {ECO:0000269\|PubMed:10358079, ECO:0000269\|PubMed:15380516, ECO:0000269\|PubMed:21555369}.	Q96AY3 Main function of 5'-partner protein: FUNCTION: PPIases accelerate the folding of proteins during protein synthesis.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000269571, ENST00000445658, ENST00000584450, ENST00000540147, ENST00000406381, ENST00000540042, ENST00000541774, ENST00000578199, ENST00000584601, ENST00000584888,	ENST00000544340, ENST00000321562,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	50 X 44 X 14=30800	8 X 9 X 3=216
	# samples	73	9
	** MAII score	log2(73/30800*10)=-5.39889007670225 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(9/216*10)=-1.26303440583379 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ERBB2 [Title/Abstract] AND FKBP10 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ERBB2 [Title/Abstract] AND FKBP10 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ERBB2(37856564)-FKBP10(39974341), # samples:1 ERBB2(37866734)-FKBP10(39977906), # samples:1 FKBP10(39969531)-ERBB2(37855790), # samples:1
Anticipated loss of major functional domain due to fusion event.	ERBB2-FKBP10 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ERBB2-FKBP10 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ERBB2-FKBP10 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ERBB2-FKBP10 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	ERBB2	GO:0007165	signal transduction	10572067
Hgene	ERBB2	GO:0007166	cell surface receptor signaling pathway	9685399
Hgene	ERBB2	GO:0007169	transmembrane receptor protein tyrosine kinase signaling pathway	7514177
Hgene	ERBB2	GO:0014065	phosphatidylinositol 3-kinase signaling	7556068
Hgene	ERBB2	GO:0018108	peptidyl-tyrosine phosphorylation	12000754
Hgene	ERBB2	GO:0032886	regulation of microtubule-based process	20937854
Hgene	ERBB2	GO:0035556	intracellular signal transduction	19372587
Hgene	ERBB2	GO:0042060	wound healing	12646923
Hgene	ERBB2	GO:0043406	positive regulation of MAP kinase activity	10572067
Hgene	ERBB2	GO:0045785	positive regulation of cell adhesion	7556068
Hgene	ERBB2	GO:0046777	protein autophosphorylation	7556068
Hgene	ERBB2	GO:0050679	positive regulation of epithelial cell proliferation	10572067
Hgene	ERBB2	GO:0071363	cellular response to growth factor stimulus	20010870
Hgene	ERBB2	GO:0090314	positive regulation of protein targeting to membrane	20010870

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:37856564/chr17:39974341)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ERBB2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across FKBP10 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000445658	ERBB2	chr17	37856564	+	ENST00000321562	FKBP10	chr17	39974341	+	2499	336	50	1693	547
ENST00000584450	ERBB2	chr17	37856564	+	ENST00000321562	FKBP10	chr17	39974341	+	2451	288	2	1645	547
ENST00000269571	ERBB2	chr17	37856564	+	ENST00000321562	FKBP10	chr17	39974341	+	2395	232	57	1589	510
ENST00000584601	ERBB2	chr17	37866734	+	ENST00000321562	FKBP10	chr17	39977906	+	2763	1608	752	1957	401
ENST00000584601	ERBB2	chr17	37866734	+	ENST00000544340	FKBP10	chr17	39977906	+	2761	1608	752	1957	401
ENST00000406381	ERBB2	chr17	37866734	+	ENST00000321562	FKBP10	chr17	39977906	+	2476	1321	510	1670	386
ENST00000406381	ERBB2	chr17	37866734	+	ENST00000544340	FKBP10	chr17	39977906	+	2474	1321	510	1670	386
ENST00000541774	ERBB2	chr17	37866734	+	ENST00000321562	FKBP10	chr17	39977906	+	2011	856	0	1205	401
ENST00000541774	ERBB2	chr17	37866734	+	ENST00000544340	FKBP10	chr17	39977906	+	2009	856	0	1205	401
ENST00000540147	ERBB2	chr17	37866734	+	ENST00000321562	FKBP10	chr17	39977906	+	2294	1139	25	1488	487
ENST00000540147	ERBB2	chr17	37866734	+	ENST00000544340	FKBP10	chr17	39977906	+	2292	1139	25	1488	487
ENST00000584450	ERBB2	chr17	37866734	+	ENST00000321562	FKBP10	chr17	39977906	+	2271	1116	2	1465	487
ENST00000584450	ERBB2	chr17	37866734	+	ENST00000544340	FKBP10	chr17	39977906	+	2269	1116	2	1465	487
ENST00000269571	ERBB2	chr17	37866734	+	ENST00000321562	FKBP10	chr17	39977906	+	2215	1060	57	1409	450
ENST00000269571	ERBB2	chr17	37866734	+	ENST00000544340	FKBP10	chr17	39977906	+	2213	1060	57	1409	450
ENST00000578199	ERBB2	chr17	37866734	+	ENST00000321562	FKBP10	chr17	39977906	+	2507	1352	541	1701	386
ENST00000578199	ERBB2	chr17	37866734	+	ENST00000544340	FKBP10	chr17	39977906	+	2505	1352	541	1701	386
ENST00000540042	ERBB2	chr17	37866734	+	ENST00000321562	FKBP10	chr17	39977906	+	2132	977	166	1326	386
ENST00000540042	ERBB2	chr17	37866734	+	ENST00000544340	FKBP10	chr17	39977906	+	2130	977	166	1326	386

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000445658	ENST00000321562	ERBB2	chr17	37856564	+	FKBP10	chr17	39974341	+	0.004090909	0.9959091
ENST00000584450	ENST00000321562	ERBB2	chr17	37856564	+	FKBP10	chr17	39974341	+	0.0042603	0.9957397
ENST00000269571	ENST00000321562	ERBB2	chr17	37856564	+	FKBP10	chr17	39974341	+	0.004281864	0.9957182
ENST00000584601	ENST00000321562	ERBB2	chr17	37866734	+	FKBP10	chr17	39977906	+	0.014205742	0.98579425
ENST00000584601	ENST00000544340	ERBB2	chr17	37866734	+	FKBP10	chr17	39977906	+	0.014090257	0.9859097
ENST00000406381	ENST00000321562	ERBB2	chr17	37866734	+	FKBP10	chr17	39977906	+	0.007245237	0.99275476
ENST00000406381	ENST00000544340	ERBB2	chr17	37866734	+	FKBP10	chr17	39977906	+	0.007204718	0.9927953
ENST00000541774	ENST00000321562	ERBB2	chr17	37866734	+	FKBP10	chr17	39977906	+	0.016335506	0.98366445
ENST00000541774	ENST00000544340	ERBB2	chr17	37866734	+	FKBP10	chr17	39977906	+	0.01628267	0.9837173
ENST00000540147	ENST00000321562	ERBB2	chr17	37866734	+	FKBP10	chr17	39977906	+	0.018813765	0.9811863
ENST00000540147	ENST00000544340	ERBB2	chr17	37866734	+	FKBP10	chr17	39977906	+	0.018728597	0.98127145
ENST00000584450	ENST00000321562	ERBB2	chr17	37866734	+	FKBP10	chr17	39977906	+	0.01944338	0.9805566
ENST00000584450	ENST00000544340	ERBB2	chr17	37866734	+	FKBP10	chr17	39977906	+	0.019323567	0.9806764
ENST00000269571	ENST00000321562	ERBB2	chr17	37866734	+	FKBP10	chr17	39977906	+	0.019612728	0.9803873
ENST00000269571	ENST00000544340	ERBB2	chr17	37866734	+	FKBP10	chr17	39977906	+	0.01947517	0.9805249
ENST00000578199	ENST00000321562	ERBB2	chr17	37866734	+	FKBP10	chr17	39977906	+	0.006147984	0.993852
ENST00000578199	ENST00000544340	ERBB2	chr17	37866734	+	FKBP10	chr17	39977906	+	0.006131643	0.9938684
ENST00000540042	ENST00000321562	ERBB2	chr17	37866734	+	FKBP10	chr17	39977906	+	0.008025953	0.99197406
ENST00000540042	ENST00000544340	ERBB2	chr17	37866734	+	FKBP10	chr17	39977906	+	0.007992579	0.9920074

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ERBB2-FKBP10

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ERBB2	chr17	37856564	FKBP10	chr17	39974341	232	213	LELPPGCVRRAGAGDFMRYHYNGSLM
ERBB2	chr17	37856564	FKBP10	chr17	39974341	232	45	STMELAALCRWGLLLALLPPGAASTQ
ERBB2	chr17	37856564	FKBP10	chr17	39974341	232	58	LLALLPPGAASTQAGLIPPDATLYFD
ERBB2	chr17	37856564	FKBP10	chr17	39974341	232	94	DTVQVSTLLRPPHCPRMVQDGDFVRY
ERBB2	chr17	37856564	FKBP10	chr17	39974341	288	131	DTVQVSTLLRPPHCPRMVQDGDFVRY
ERBB2	chr17	37856564	FKBP10	chr17	39974341	288	250	LELPPGCVRRAGAGDFMRYHYNGSLM
ERBB2	chr17	37856564	FKBP10	chr17	39974341	288	82	STMELAALCRWGLLLALLPPGAASTQ
ERBB2	chr17	37856564	FKBP10	chr17	39974341	288	95	LLALLPPGAASTQAGLIPPDATLYFD
ERBB2	chr17	37856564	FKBP10	chr17	39974341	336	131	DTVQVSTLLRPPHCPRMVQDGDFVRY
ERBB2	chr17	37856564	FKBP10	chr17	39974341	336	250	LELPPGCVRRAGAGDFMRYHYNGSLM
ERBB2	chr17	37856564	FKBP10	chr17	39974341	336	82	STMELAALCRWGLLLALLPPGAASTQ
ERBB2	chr17	37856564	FKBP10	chr17	39974341	336	95	LLALLPPGAASTQAGLIPPDATLYFD
ERBB2	chr17	37866734	FKBP10	chr17	39977906	1060	333	GRYTFGASCVTACPSRGVPGSAVLLF
ERBB2	chr17	37866734	FKBP10	chr17	39977906	1116	370	GRYTFGASCVTACPSRGVPGSAVLLF
ERBB2	chr17	37866734	FKBP10	chr17	39977906	1139	370	GRYTFGASCVTACPSRGVPGSAVLLF
ERBB2	chr17	37866734	FKBP10	chr17	39977906	1321	269	GRYTFGASCVTACPSRGVPGSAVLLF
ERBB2	chr17	37866734	FKBP10	chr17	39977906	1352	269	GRYTFGASCVTACPSRGVPGSAVLLF
ERBB2	chr17	37866734	FKBP10	chr17	39977906	1608	284	GRYTFGASCVTACPSRGVPGSAVLLF
ERBB2	chr17	37866734	FKBP10	chr17	39977906	856	284	GRYTFGASCVTACPSRGVPGSAVLLF
ERBB2	chr17	37866734	FKBP10	chr17	39977906	977	269	GRYTFGASCVTACPSRGVPGSAVLLF

Top

Potential FusionNeoAntigen Information of ERBB2-FKBP10 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ERBB2-FKBP10_37856564_39974341.msa
ERBB2-FKBP10_37866734_39977906.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-B27:04	RRAGAGDFM	0.9978	0.8006	8	17
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-B27:07	RRAGAGDFM	0.9946	0.6002	8	17
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-A80:01	AGAGDFMRY	0.5927	0.6015	10	19
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-B27:05	RRAGAGDFMR	0.9997	0.6447	8	18
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-B15:17	RAGAGDFMRY	0.9914	0.9797	9	19
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-A80:01	RAGAGDFMRY	0.8819	0.5842	9	19
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-B27:04	RRAGAGDFMRY	0.9999	0.8158	8	19
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-B27:02	RRAGAGDFMRY	0.9999	0.5113	8	19
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-B27:05	RRAGAGDFMRY	0.9999	0.7402	8	19
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-C07:95	RRAGAGDFM	0.9819	0.6374	8	17
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-C07:27	RRAGAGDFM	0.9634	0.951	8	17
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-C07:19	RRAGAGDFM	0.7918	0.6998	8	17
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-C07:46	RRAGAGDFM	0.7681	0.8857	8	17
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-B27:14	RRAGAGDFMR	0.9997	0.6367	8	18
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-B27:03	RRAGAGDFMR	0.9963	0.6678	8	18
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-C15:04	RAGAGDFMRY	0.9759	0.9718	9	19
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-B27:14	RRAGAGDFMRY	0.9998	0.6765	8	19
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-C07:19	RRAGAGDFMRY	0.9995	0.7575	8	19
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-B27:03	RRAGAGDFMRY	0.9993	0.7549	8	19
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-C07:46	RRAGAGDFMRY	0.9987	0.8967	8	19
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-B27:08	RRAGAGDFM	0.9982	0.5977	8	17
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-B27:06	RRAGAGDFM	0.9969	0.8095	8	17
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-B27:09	RRAGAGDFM	0.9942	0.6778	8	17
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-C07:01	RRAGAGDFM	0.9841	0.5963	8	17
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-C07:22	RRAGAGDFM	0.6979	0.6696	8	17
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-B27:10	RRAGAGDFMR	0.9994	0.8789	8	18
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-C15:09	RAGAGDFMRY	0.9759	0.9718	9	19
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-B27:10	RRAGAGDFMRY	0.9999	0.9014	8	19
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-B27:08	RRAGAGDFMRY	0.9999	0.6498	8	19
ERBB2-FKBP10	chr17	37856564	chr17	39974341	232	HLA-C07:01	RRAGAGDFMRY	0.9997	0.6604	8	19
ERBB2-FKBP10	chr17	37866734	chr17	39977906	1060	HLA-B56:01	CPSRGVPGSA	0.8401	0.602	12	22
ERBB2-FKBP10	chr17	37866734	chr17	39977906	1060	HLA-B54:01	CPSRGVPGSA	0.9519	0.8261	12	22
ERBB2-FKBP10	chr17	37866734	chr17	39977906	1060	HLA-B55:02	CPSRGVPGSA	0.8733	0.6288	12	22

Top

Potential FusionNeoAntigen Information of ERBB2-FKBP10 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of ERBB2-FKBP10

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
580	ASCVTACPSRGVPG	ERBB2	FKBP10	chr17	37866734	chr17	39977906	1060

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
965	CVRRAGAGDFMRYH	ERBB2	FKBP10	chr17	37856564	chr17	39974341	232

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ERBB2-FKBP10

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B52:01	3W39	580	ASCVTACPSRGVPG	-7.90165	-7.90165
HLA-B44:05	3DX8	580	ASCVTACPSRGVPG	-5.81679	-5.81679
HLA-B14:02	3BVN	965	CVRRAGAGDFMRYH	-7.15543	-7.26883
HLA-B14:02	3BVN	965	CVRRAGAGDFMRYH	-4.77435	-5.80965
HLA-B52:01	3W39	965	CVRRAGAGDFMRYH	-6.80875	-6.92215
HLA-B52:01	3W39	965	CVRRAGAGDFMRYH	-4.20386	-5.23916
HLA-A11:01	4UQ2	965	CVRRAGAGDFMRYH	-7.5194	-8.5547
HLA-A11:01	4UQ2	965	CVRRAGAGDFMRYH	-6.9601	-7.0735
HLA-A24:02	5HGA	965	CVRRAGAGDFMRYH	-7.52403	-7.63743
HLA-A24:02	5HGA	965	CVRRAGAGDFMRYH	-5.82433	-6.85963
HLA-B27:05	6PYJ	965	CVRRAGAGDFMRYH	-3.28285	-4.31815
HLA-B44:05	3DX8	965	CVRRAGAGDFMRYH	-5.91172	-6.94702
HLA-B44:05	3DX8	965	CVRRAGAGDFMRYH	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of ERBB2-FKBP10

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ERBB2-FKBP10	chr17	37856564	chr17	39974341	10	19	AGAGDFMRY	GCACCCAAGCGGGGCTCATTCCACCGG
ERBB2-FKBP10	chr17	37856564	chr17	39974341	8	17	RRAGAGDFM	CCGCGAGCACCCAAGCGGGGCTCATTC
ERBB2-FKBP10	chr17	37856564	chr17	39974341	8	18	RRAGAGDFMR	CCGCGAGCACCCAAGCGGGGCTCATTCCAC
ERBB2-FKBP10	chr17	37856564	chr17	39974341	8	19	RRAGAGDFMRY	CCGCGAGCACCCAAGCGGGGCTCATTCCACCGG
ERBB2-FKBP10	chr17	37856564	chr17	39974341	9	19	RAGAGDFMRY	CGAGCACCCAAGCGGGGCTCATTCCACCGG
ERBB2-FKBP10	chr17	37866734	chr17	39977906	12	22	CPSRGVPGSA	CCTCCCGGGGAGTCCCAGGCAGTGCTGTGC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of ERBB2-FKBP10

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	ERBB2-FKBP10	chr17	37856564	ENST00000269571	chr17	39974341	ENST00000321562	TCGA-RD-A7BT-01A
STAD	ERBB2-FKBP10	chr17	37866734	ENST00000269571	chr17	39977906	ENST00000321562	TCGA-RD-A7BT-01A

Top

Potential target of CAR-T therapy development for ERBB2-FKBP10

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ERBB2-FKBP10

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ERBB2-FKBP10

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)