Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ERBB2IP-ASXL1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ERBB2IP-ASXL1
	FusionPDB ID: 27153
	FusionGDB2.0 ID: 27153
		Hgene	Tgene
	Gene symbol	ERBB2IP	ASXL1
	Gene ID	55914	171023
	Gene name	erbb2 interacting protein	ASXL transcriptional regulator 1
	Synonyms	ERBB2IP\|HEL-S-78\|LAP2	BOPS\|MDS
	Cytomap	5q12.3	20q11.21
	Type of gene	protein-coding	protein-coding
	Description	erbindensin-180-like proteinepididymis secretory protein Li 78protein LAP2	polycomb group protein ASXL1additional sex combs like 1, transcriptional regulatoradditional sex combs like transcriptional regulator 1putative Polycomb group protein ASXL1
	Modification date	20200322	20200313
	UniProtAcc	.	Q8IXJ9 Main function of 5'-partner protein: FUNCTION: Probable Polycomb group (PcG) protein involved in transcriptional regulation mediated by ligand-bound nuclear hormone receptors, such as retinoic acid receptors (RARs) and peroxisome proliferator-activated receptor gamma (PPARG) (PubMed:16606617). Acts as coactivator of RARA and RXRA through association with NCOA1 (PubMed:16606617). Acts as corepressor for PPARG and suppresses its adipocyte differentiation-inducing activity (By similarity). Non-catalytic component of the PR-DUB complex, a complex that specifically mediates deubiquitination of histone H2A monoubiquitinated at 'Lys-119' (H2AK119ub1) (PubMed:20436459). Acts as a sensor of N(6)-methyladenosine methylation on DNA (m6A): recognizes and binds m6A DNA, leading to its ubiquitination and degradation by TRIP12, thereby inactivating the PR-DUB complex and regulating Polycomb silencing (PubMed:30982744). {ECO:0000250\|UniProtKB:P59598, ECO:0000269\|PubMed:16606617, ECO:0000269\|PubMed:20436459, ECO:0000269\|PubMed:30982744}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000284037, ENST00000380935, ENST00000380936, ENST00000380938, ENST00000380939, ENST00000380943, ENST00000506030, ENST00000508515, ENST00000511297, ENST00000416865, ENST00000503913,	ENST00000470145, ENST00000542461, ENST00000306058, ENST00000375689, ENST00000375687,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	14 X 4 X 10=560	10 X 7 X 6=420
	# samples	20	10
	** MAII score	log2(20/560*10)=-1.48542682717024 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(10/420*10)=-2.0703893278914 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ERBB2IP [Title/Abstract] AND ASXL1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ERBB2IP [Title/Abstract] AND ASXL1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ERBB2IP(65350779)-ASXL1(31015931), # samples:1
Anticipated loss of major functional domain due to fusion event.	ERBB2IP-ASXL1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ERBB2IP-ASXL1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ERBB2IP-ASXL1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ERBB2IP-ASXL1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	ASXL1	GO:0035522	monoubiquitinated histone H2A deubiquitination	20436459

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr5:65350779/chr20:31015931)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ERBB2IP (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ASXL1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000284037	ERBB2IP	chr5	65350779	-	ENST00000375687	ASXL1	chr20	31015931	+	10377	4022	389	8395	2668
ENST00000380943	ERBB2IP	chr5	65350779	-	ENST00000375687	ASXL1	chr20	31015931	+	10296	3941	308	8314	2668
ENST00000380935	ERBB2IP	chr5	65350779	-	ENST00000375687	ASXL1	chr20	31015931	+	10278	3923	290	8296	2668
ENST00000380939	ERBB2IP	chr5	65350779	-	ENST00000375687	ASXL1	chr20	31015931	+	10278	3923	290	8296	2668
ENST00000380936	ERBB2IP	chr5	65350779	-	ENST00000375687	ASXL1	chr20	31015931	+	10278	3923	290	8296	2668
ENST00000380938	ERBB2IP	chr5	65350779	-	ENST00000375687	ASXL1	chr20	31015931	+	10242	3887	254	8260	2668
ENST00000511297	ERBB2IP	chr5	65350779	-	ENST00000375687	ASXL1	chr20	31015931	+	10113	3758	137	8131	2664
ENST00000506030	ERBB2IP	chr5	65350779	-	ENST00000375687	ASXL1	chr20	31015931	+	10079	3724	91	8097	2668
ENST00000508515	ERBB2IP	chr5	65350779	-	ENST00000375687	ASXL1	chr20	31015931	+	10047	3692	59	8065	2668

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000284037	ENST00000375687	ERBB2IP	chr5	65350779	-	ASXL1	chr20	31015931	+	0.00091832	0.9990816
ENST00000380943	ENST00000375687	ERBB2IP	chr5	65350779	-	ASXL1	chr20	31015931	+	0.000824435	0.9991755
ENST00000380935	ENST00000375687	ERBB2IP	chr5	65350779	-	ASXL1	chr20	31015931	+	0.000807242	0.9991928
ENST00000380939	ENST00000375687	ERBB2IP	chr5	65350779	-	ASXL1	chr20	31015931	+	0.000807242	0.9991928
ENST00000380936	ENST00000375687	ERBB2IP	chr5	65350779	-	ASXL1	chr20	31015931	+	0.000807242	0.9991928
ENST00000380938	ENST00000375687	ERBB2IP	chr5	65350779	-	ASXL1	chr20	31015931	+	0.000766601	0.99923337
ENST00000511297	ENST00000375687	ERBB2IP	chr5	65350779	-	ASXL1	chr20	31015931	+	0.000679897	0.99932015
ENST00000506030	ENST00000375687	ERBB2IP	chr5	65350779	-	ASXL1	chr20	31015931	+	0.000632266	0.9993678
ENST00000508515	ENST00000375687	ERBB2IP	chr5	65350779	-	ASXL1	chr20	31015931	+	0.000613716	0.9993863

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ERBB2IP-ASXL1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ERBB2IP	chr5	65350779	ASXL1	chr20	31015931	3692	1211	QVLRHIEAKKLEKKDALQWSRHPATV
ERBB2IP	chr5	65350779	ASXL1	chr20	31015931	3724	1211	QVLRHIEAKKLEKKDALQWSRHPATV
ERBB2IP	chr5	65350779	ASXL1	chr20	31015931	3758	1207	QVLRHIEAKKLEKKDALQWSRHPATV
ERBB2IP	chr5	65350779	ASXL1	chr20	31015931	3887	1211	QVLRHIEAKKLEKKDALQWSRHPATV
ERBB2IP	chr5	65350779	ASXL1	chr20	31015931	3923	1211	QVLRHIEAKKLEKKDALQWSRHPATV
ERBB2IP	chr5	65350779	ASXL1	chr20	31015931	3941	1211	QVLRHIEAKKLEKKDALQWSRHPATV
ERBB2IP	chr5	65350779	ASXL1	chr20	31015931	4022	1211	QVLRHIEAKKLEKKDALQWSRHPATV

Top

Potential FusionNeoAntigen Information of ERBB2IP-ASXL1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ERBB2IP-ASXL1_65350779_31015931.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:03	LEKKDALQW	0.9983	0.9602	10	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:02	LEKKDALQW	0.9971	0.5417	10	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B47:01	LEKKDALQW	0.9862	0.7437	10	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:05	LEKKDALQW	0.9862	0.6199	10	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B14:02	KKLEKKDAL	0.7409	0.6005	8	17
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B14:01	KKLEKKDAL	0.7409	0.6005	8	17
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B39:13	KKLEKKDAL	0.3684	0.7965	8	17
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B57:01	KLEKKDALQW	0.9982	0.989	9	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B58:01	KLEKKDALQW	0.9795	0.9812	9	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-A32:13	KLEKKDALQW	0.8264	0.9741	9	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:02	KLEKKDALQW	0.8178	0.5837	9	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:03	KLEKKDALQW	0.7583	0.978	9	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:05	KLEKKDALQW	0.7486	0.658	9	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:02	KKLEKKDALQW	0.9945	0.6306	8	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:03	KKLEKKDALQW	0.993	0.9821	8	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:04	LEKKDALQW	0.9971	0.5329	10	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:08	LEKKDALQW	0.9961	0.679	10	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:09	LEKKDALQW	0.9909	0.6878	10	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:10	LEKKDALQW	0.7177	0.8215	10	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B14:03	KKLEKKDAL	0.2862	0.5995	8	17
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:04	KLEKKDALQW	0.8879	0.613	9	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:08	KLEKKDALQW	0.7973	0.7026	9	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:08	KKLEKKDALQW	0.9914	0.7318	8	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:04	KKLEKKDALQW	0.9912	0.6654	8	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:13	LEKKDALQW	0.9983	0.9602	10	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:07	LEKKDALQW	0.9983	0.9602	10	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:26	LEKKDALQW	0.9983	0.9602	10	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:22	LEKKDALQW	0.9971	0.5417	10	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B39:02	KKLEKKDAL	0.6553	0.804	8	17
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B15:24	LEKKDALQW	0.6396	0.9622	10	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B15:13	LEKKDALQW	0.5705	0.9497	10	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B48:02	LEKKDALQW	0.1967	0.8819	10	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B57:10	KLEKKDALQW	0.9982	0.989	9	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B57:04	KLEKKDALQW	0.9945	0.8505	9	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B15:24	KLEKKDALQW	0.9567	0.9787	9	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-A32:01	KLEKKDALQW	0.9239	0.9869	9	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:22	KLEKKDALQW	0.8178	0.5837	9	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:13	KLEKKDALQW	0.7583	0.978	9	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:26	KLEKKDALQW	0.7583	0.978	9	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:07	KLEKKDALQW	0.7583	0.978	9	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:21	KKLEKKDALQW	0.9967	0.5054	8	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:22	KKLEKKDALQW	0.9945	0.6306	8	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:13	KKLEKKDALQW	0.993	0.9821	8	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:07	KKLEKKDALQW	0.993	0.9821	8	19
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	HLA-B44:26	KKLEKKDALQW	0.993	0.9821	8	19

Top

Potential FusionNeoAntigen Information of ERBB2IP-ASXL1 in HLA II

ERBB2IP-ASXL1_65350779_31015931.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	DRB1-0103	QVLRHIEAKKLEKKD	0	15
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	DRB1-0123	QVLRHIEAKKLEKKD	0	15
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	DRB1-1208	QVLRHIEAKKLEKKD	0	15
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	4022	DRB1-1221	QVLRHIEAKKLEKKD	0	15

Top

Fusion breakpoint peptide structures of ERBB2IP-ASXL1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
1528	EAKKLEKKDALQWS	ERBB2IP	ASXL1	chr5	65350779	chr20	31015931	4022

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ERBB2IP-ASXL1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	1528	EAKKLEKKDALQWS	-7.9962	-8.1096
HLA-B14:02	3BVN	1528	EAKKLEKKDALQWS	-5.70842	-6.74372
HLA-B52:01	3W39	1528	EAKKLEKKDALQWS	-6.83737	-6.95077
HLA-B52:01	3W39	1528	EAKKLEKKDALQWS	-4.4836	-5.5189
HLA-A11:01	4UQ2	1528	EAKKLEKKDALQWS	-10.0067	-10.1201
HLA-A11:01	4UQ2	1528	EAKKLEKKDALQWS	-9.03915	-10.0745
HLA-A24:02	5HGA	1528	EAKKLEKKDALQWS	-6.56204	-6.67544
HLA-A24:02	5HGA	1528	EAKKLEKKDALQWS	-5.42271	-6.45801
HLA-B44:05	3DX8	1528	EAKKLEKKDALQWS	-7.85648	-8.89178
HLA-B44:05	3DX8	1528	EAKKLEKKDALQWS	-5.3978	-5.5112
HLA-A02:01	6TDR	1528	EAKKLEKKDALQWS	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of ERBB2IP-ASXL1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	10	19	LEKKDALQW	TTAGAAAAGAAGGATGCCCTGCAGTGG
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	8	17	KKLEKKDAL	AAAAAGTTAGAAAAGAAGGATGCCCTG
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	8	19	KKLEKKDALQW	AAAAAGTTAGAAAAGAAGGATGCCCTGCAGTGG
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	9	19	KLEKKDALQW	AAGTTAGAAAAGAAGGATGCCCTGCAGTGG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
ERBB2IP-ASXL1	chr5	65350779	chr20	31015931	0	15	QVLRHIEAKKLEKKD	CAAGTACTTCGACATATTGAAGCCAAAAAGTTAGAAAAGAAGGAT

Top

Information of the samples that have these potential fusion neoantigens of ERBB2IP-ASXL1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LUAD	ERBB2IP-ASXL1	chr5	65350779	ENST00000284037	chr20	31015931	ENST00000375687	TCGA-50-5944-01A

Top

Potential target of CAR-T therapy development for ERBB2IP-ASXL1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ERBB2IP-ASXL1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ERBB2IP-ASXL1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)