Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ERBB2-TATDN1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ERBB2-TATDN1
	FusionPDB ID: 27198
	FusionGDB2.0 ID: 27198
		Hgene	Tgene
	Gene symbol	ERBB2	TATDN1
	Gene ID	2064	83940
	Gene name	erb-b2 receptor tyrosine kinase 2	TatD DNase domain containing 1
	Synonyms	CD340\|HER-2\|HER-2/neu\|HER2\|MLN 19\|NEU\|NGL\|TKR1	CDA11
	Cytomap	17q12	8q24.13
	Type of gene	protein-coding	protein-coding
	Description	receptor tyrosine-protein kinase erbB-2c-erb B2/neu proteinherstatinhuman epidermal growth factor receptor 2metastatic lymph node gene 19 proteinneuro/glioblastoma derived oncogene homologneuroblastoma/glioblastoma derived oncogene homologp185erbB2	putative deoxyribonuclease TATDN1hepatocarcinoma high expression protein
	Modification date	20200329	20200313
	UniProtAcc	P04626 Main function of 5'-partner protein: FUNCTION: Protein tyrosine kinase that is part of several cell surface receptor complexes, but that apparently needs a coreceptor for ligand binding. Essential component of a neuregulin-receptor complex, although neuregulins do not interact with it alone. GP30 is a potential ligand for this receptor. Regulates outgrowth and stabilization of peripheral microtubules (MTs). Upon ERBB2 activation, the MEMO1-RHOA-DIAPH1 signaling pathway elicits the phosphorylation and thus the inhibition of GSK3B at cell membrane. This prevents the phosphorylation of APC and CLASP2, allowing its association with the cell membrane. In turn, membrane-bound APC allows the localization of MACF1 to the cell membrane, which is required for microtubule capture and stabilization. {ECO:0000305}.; FUNCTION: In the nucleus is involved in transcriptional regulation. Associates with the 5'-TCAAATTC-3' sequence in the PTGS2/COX-2 promoter and activates its transcription. Implicated in transcriptional activation of CDKN1A; the function involves STAT3 and SRC. Involved in the transcription of rRNA genes by RNA Pol I and enhances protein synthesis and cell growth. {ECO:0000269\|PubMed:10358079, ECO:0000269\|PubMed:15380516, ECO:0000269\|PubMed:21555369}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000269571, ENST00000406381, ENST00000445658, ENST00000540042, ENST00000540147, ENST00000541774, ENST00000578199, ENST00000584450, ENST00000584601, ENST00000584888,	ENST00000521546, ENST00000605953, ENST00000276692, ENST00000517678, ENST00000519548,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	50 X 44 X 14=30800	7 X 4 X 5=140
	# samples	73	7
	** MAII score	log2(73/30800*10)=-5.39889007670225 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(7/140*10)=-1 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ERBB2 [Title/Abstract] AND TATDN1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ERBB2 [Title/Abstract] AND TATDN1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ERBB2(37868701)-TATDN1(125507783), # samples:2
Anticipated loss of major functional domain due to fusion event.	ERBB2-TATDN1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ERBB2-TATDN1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	ERBB2	GO:0007165	signal transduction	10572067
Hgene	ERBB2	GO:0007166	cell surface receptor signaling pathway	9685399
Hgene	ERBB2	GO:0007169	transmembrane receptor protein tyrosine kinase signaling pathway	7514177
Hgene	ERBB2	GO:0014065	phosphatidylinositol 3-kinase signaling	7556068
Hgene	ERBB2	GO:0018108	peptidyl-tyrosine phosphorylation	12000754
Hgene	ERBB2	GO:0032886	regulation of microtubule-based process	20937854
Hgene	ERBB2	GO:0035556	intracellular signal transduction	19372587
Hgene	ERBB2	GO:0042060	wound healing	12646923
Hgene	ERBB2	GO:0043406	positive regulation of MAP kinase activity	10572067
Hgene	ERBB2	GO:0045785	positive regulation of cell adhesion	7556068
Hgene	ERBB2	GO:0046777	protein autophosphorylation	7556068
Hgene	ERBB2	GO:0050679	positive regulation of epithelial cell proliferation	10572067
Hgene	ERBB2	GO:0071363	cellular response to growth factor stimulus	20010870
Hgene	ERBB2	GO:0090314	positive regulation of protein targeting to membrane	20010870

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:37868701/chr8:125507783)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ERBB2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across TATDN1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000584601	ERBB2	chr17	37868701	+	ENST00000276692	TATDN1	chr8	125507783	-	2242	1855	752	2155	467
ENST00000584601	ERBB2	chr17	37868701	+	ENST00000519548	TATDN1	chr8	125507783	-	2237	1855	752	2155	467
ENST00000584601	ERBB2	chr17	37868701	+	ENST00000517678	TATDN1	chr8	125507783	-	2062	1855	752	2056	434
ENST00000406381	ERBB2	chr17	37868701	+	ENST00000276692	TATDN1	chr8	125507783	-	1955	1568	510	1868	452
ENST00000406381	ERBB2	chr17	37868701	+	ENST00000519548	TATDN1	chr8	125507783	-	1950	1568	510	1868	452
ENST00000406381	ERBB2	chr17	37868701	+	ENST00000517678	TATDN1	chr8	125507783	-	1775	1568	510	1769	419
ENST00000541774	ERBB2	chr17	37868701	+	ENST00000276692	TATDN1	chr8	125507783	-	1490	1103	0	1403	467
ENST00000541774	ERBB2	chr17	37868701	+	ENST00000519548	TATDN1	chr8	125507783	-	1485	1103	0	1403	467
ENST00000541774	ERBB2	chr17	37868701	+	ENST00000517678	TATDN1	chr8	125507783	-	1310	1103	0	1304	434
ENST00000445658	ERBB2	chr17	37868701	+	ENST00000276692	TATDN1	chr8	125507783	-	970	583	50	883	277
ENST00000445658	ERBB2	chr17	37868701	+	ENST00000519548	TATDN1	chr8	125507783	-	965	583	50	883	277
ENST00000445658	ERBB2	chr17	37868701	+	ENST00000517678	TATDN1	chr8	125507783	-	790	583	50	784	244
ENST00000540147	ERBB2	chr17	37868701	+	ENST00000276692	TATDN1	chr8	125507783	-	1773	1386	25	1686	553
ENST00000540147	ERBB2	chr17	37868701	+	ENST00000519548	TATDN1	chr8	125507783	-	1768	1386	25	1686	553
ENST00000540147	ERBB2	chr17	37868701	+	ENST00000517678	TATDN1	chr8	125507783	-	1593	1386	25	1587	520
ENST00000584450	ERBB2	chr17	37868701	+	ENST00000276692	TATDN1	chr8	125507783	-	1750	1363	2	1663	553
ENST00000584450	ERBB2	chr17	37868701	+	ENST00000519548	TATDN1	chr8	125507783	-	1745	1363	2	1663	553
ENST00000584450	ERBB2	chr17	37868701	+	ENST00000517678	TATDN1	chr8	125507783	-	1570	1363	2	1564	520
ENST00000269571	ERBB2	chr17	37868701	+	ENST00000276692	TATDN1	chr8	125507783	-	1694	1307	57	1607	516
ENST00000269571	ERBB2	chr17	37868701	+	ENST00000519548	TATDN1	chr8	125507783	-	1689	1307	57	1607	516
ENST00000269571	ERBB2	chr17	37868701	+	ENST00000517678	TATDN1	chr8	125507783	-	1514	1307	57	1508	483
ENST00000578199	ERBB2	chr17	37868701	+	ENST00000276692	TATDN1	chr8	125507783	-	1986	1599	541	1899	452
ENST00000578199	ERBB2	chr17	37868701	+	ENST00000519548	TATDN1	chr8	125507783	-	1981	1599	541	1899	452
ENST00000578199	ERBB2	chr17	37868701	+	ENST00000517678	TATDN1	chr8	125507783	-	1806	1599	541	1800	419
ENST00000540042	ERBB2	chr17	37868701	+	ENST00000276692	TATDN1	chr8	125507783	-	1611	1224	166	1524	452
ENST00000540042	ERBB2	chr17	37868701	+	ENST00000519548	TATDN1	chr8	125507783	-	1606	1224	166	1524	452
ENST00000540042	ERBB2	chr17	37868701	+	ENST00000517678	TATDN1	chr8	125507783	-	1431	1224	166	1425	419

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000584601	ENST00000276692	ERBB2	chr17	37868701	+	TATDN1	chr8	125507783	-	0.010868711	0.98913133
ENST00000584601	ENST00000519548	ERBB2	chr17	37868701	+	TATDN1	chr8	125507783	-	0.010736646	0.98926336
ENST00000584601	ENST00000517678	ERBB2	chr17	37868701	+	TATDN1	chr8	125507783	-	0.025816578	0.97418344
ENST00000406381	ENST00000276692	ERBB2	chr17	37868701	+	TATDN1	chr8	125507783	-	0.006573862	0.9934262
ENST00000406381	ENST00000519548	ERBB2	chr17	37868701	+	TATDN1	chr8	125507783	-	0.006457959	0.9935421
ENST00000406381	ENST00000517678	ERBB2	chr17	37868701	+	TATDN1	chr8	125507783	-	0.016449496	0.98355055
ENST00000541774	ENST00000276692	ERBB2	chr17	37868701	+	TATDN1	chr8	125507783	-	0.012694387	0.98730564
ENST00000541774	ENST00000519548	ERBB2	chr17	37868701	+	TATDN1	chr8	125507783	-	0.012386638	0.9876133
ENST00000541774	ENST00000517678	ERBB2	chr17	37868701	+	TATDN1	chr8	125507783	-	0.03470939	0.9652906
ENST00000445658	ENST00000276692	ERBB2	chr17	37868701	+	TATDN1	chr8	125507783	-	0.005850011	0.99415004
ENST00000445658	ENST00000519548	ERBB2	chr17	37868701	+	TATDN1	chr8	125507783	-	0.005911069	0.994089
ENST00000445658	ENST00000517678	ERBB2	chr17	37868701	+	TATDN1	chr8	125507783	-	0.045413803	0.95458627
ENST00000540147	ENST00000276692	ERBB2	chr17	37868701	+	TATDN1	chr8	125507783	-	0.023014994	0.976985
ENST00000540147	ENST00000519548	ERBB2	chr17	37868701	+	TATDN1	chr8	125507783	-	0.022551803	0.97744817
ENST00000540147	ENST00000517678	ERBB2	chr17	37868701	+	TATDN1	chr8	125507783	-	0.052665398	0.9473346
ENST00000584450	ENST00000276692	ERBB2	chr17	37868701	+	TATDN1	chr8	125507783	-	0.024392	0.975608
ENST00000584450	ENST00000519548	ERBB2	chr17	37868701	+	TATDN1	chr8	125507783	-	0.023834929	0.97616506
ENST00000584450	ENST00000517678	ERBB2	chr17	37868701	+	TATDN1	chr8	125507783	-	0.055690765	0.9443093
ENST00000269571	ENST00000276692	ERBB2	chr17	37868701	+	TATDN1	chr8	125507783	-	0.02399535	0.97600466
ENST00000269571	ENST00000519548	ERBB2	chr17	37868701	+	TATDN1	chr8	125507783	-	0.023417732	0.9765822
ENST00000269571	ENST00000517678	ERBB2	chr17	37868701	+	TATDN1	chr8	125507783	-	0.055287834	0.9447122
ENST00000578199	ENST00000276692	ERBB2	chr17	37868701	+	TATDN1	chr8	125507783	-	0.004981235	0.9950187
ENST00000578199	ENST00000519548	ERBB2	chr17	37868701	+	TATDN1	chr8	125507783	-	0.004944351	0.9950557
ENST00000578199	ENST00000517678	ERBB2	chr17	37868701	+	TATDN1	chr8	125507783	-	0.012103243	0.9878968
ENST00000540042	ENST00000276692	ERBB2	chr17	37868701	+	TATDN1	chr8	125507783	-	0.006186235	0.99381375
ENST00000540042	ENST00000519548	ERBB2	chr17	37868701	+	TATDN1	chr8	125507783	-	0.006071548	0.99392843
ENST00000540042	ENST00000517678	ERBB2	chr17	37868701	+	TATDN1	chr8	125507783	-	0.016951181	0.9830488

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ERBB2-TATDN1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ERBB2	chr17	37868701	TATDN1	chr8	125507783	1103	368	FGSLAFLPESFDGSLKTEANLEVLKS
ERBB2	chr17	37868701	TATDN1	chr8	125507783	1224	353	FGSLAFLPESFDGSLKTEANLEVLKS
ERBB2	chr17	37868701	TATDN1	chr8	125507783	1307	417	FGSLAFLPESFDGSLKTEANLEVLKS
ERBB2	chr17	37868701	TATDN1	chr8	125507783	1363	454	FGSLAFLPESFDGSLKTEANLEVLKS
ERBB2	chr17	37868701	TATDN1	chr8	125507783	1386	454	FGSLAFLPESFDGSLKTEANLEVLKS
ERBB2	chr17	37868701	TATDN1	chr8	125507783	1568	353	FGSLAFLPESFDGSLKTEANLEVLKS
ERBB2	chr17	37868701	TATDN1	chr8	125507783	1599	353	FGSLAFLPESFDGSLKTEANLEVLKS
ERBB2	chr17	37868701	TATDN1	chr8	125507783	1855	368	FGSLAFLPESFDGSLKTEANLEVLKS
ERBB2	chr17	37868701	TATDN1	chr8	125507783	583	178	FGSLAFLPESFDGSLKTEANLEVLKS

Top

Potential FusionNeoAntigen Information of ERBB2-TATDN1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ERBB2-TATDN1_37868701_125507783.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ERBB2-TATDN1	chr17	37868701	chr8	125507783	1307	HLA-B35:08	LPESFDGSL	0.9594	0.8274	6	15
ERBB2-TATDN1	chr17	37868701	chr8	125507783	1307	HLA-B35:03	LPESFDGSL	0.951	0.8554	6	15
ERBB2-TATDN1	chr17	37868701	chr8	125507783	1307	HLA-B35:04	LPESFDGSL	0.8033	0.8834	6	15
ERBB2-TATDN1	chr17	37868701	chr8	125507783	1307	HLA-B35:02	LPESFDGSL	0.8033	0.8834	6	15
ERBB2-TATDN1	chr17	37868701	chr8	125507783	1307	HLA-A02:22	FLPESFDGSL	0.9826	0.7272	5	15
ERBB2-TATDN1	chr17	37868701	chr8	125507783	1307	HLA-B35:03	FLPESFDGSL	0.8104	0.9502	5	15
ERBB2-TATDN1	chr17	37868701	chr8	125507783	1307	HLA-B35:04	FLPESFDGSL	0.7124	0.9553	5	15
ERBB2-TATDN1	chr17	37868701	chr8	125507783	1307	HLA-B35:02	FLPESFDGSL	0.7124	0.9553	5	15
ERBB2-TATDN1	chr17	37868701	chr8	125507783	1307	HLA-B35:12	LPESFDGSL	0.8033	0.8834	6	15
ERBB2-TATDN1	chr17	37868701	chr8	125507783	1307	HLA-B39:10	LPESFDGSL	0.6149	0.873	6	15
ERBB2-TATDN1	chr17	37868701	chr8	125507783	1307	HLA-A02:02	FLPESFDGSL	0.9835	0.6176	5	15
ERBB2-TATDN1	chr17	37868701	chr8	125507783	1307	HLA-C01:17	FLPESFDGSL	0.9745	0.9815	5	15
ERBB2-TATDN1	chr17	37868701	chr8	125507783	1307	HLA-A02:05	FLPESFDGSL	0.9726	0.7475	5	15
ERBB2-TATDN1	chr17	37868701	chr8	125507783	1307	HLA-A02:07	FLPESFDGSL	0.9655	0.7201	5	15
ERBB2-TATDN1	chr17	37868701	chr8	125507783	1307	HLA-C01:30	FLPESFDGSL	0.9403	0.9845	5	15
ERBB2-TATDN1	chr17	37868701	chr8	125507783	1307	HLA-B35:12	FLPESFDGSL	0.7124	0.9553	5	15
ERBB2-TATDN1	chr17	37868701	chr8	125507783	1307	HLA-B35:09	LPESFDGSL	0.8033	0.8834	6	15
ERBB2-TATDN1	chr17	37868701	chr8	125507783	1307	HLA-B67:01	LPESFDGSL	0.6648	0.5914	6	15
ERBB2-TATDN1	chr17	37868701	chr8	125507783	1307	HLA-C01:03	FLPESFDGSL	0.9958	0.9499	5	15
ERBB2-TATDN1	chr17	37868701	chr8	125507783	1307	HLA-C01:02	FLPESFDGSL	0.9834	0.9805	5	15
ERBB2-TATDN1	chr17	37868701	chr8	125507783	1307	HLA-B35:09	FLPESFDGSL	0.7124	0.9553	5	15

Top

Potential FusionNeoAntigen Information of ERBB2-TATDN1 in HLA II

ERBB2-TATDN1_37868701_125507783.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ERBB2-TATDN1	chr17	37868701	chr8	125507783	1307	DRB1-1525	DGSLKTEANLEVLKS	11	26
ERBB2-TATDN1	chr17	37868701	chr8	125507783	1307	DRB1-1525	FDGSLKTEANLEVLK	10	25

Top

Fusion breakpoint peptide structures of ERBB2-TATDN1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
5380	LPESFDGSLKTEAN	ERBB2	TATDN1	chr17	37868701	chr8	125507783	1307

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ERBB2-TATDN1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	5380	LPESFDGSLKTEAN	-7.9962	-8.1096
HLA-B14:02	3BVN	5380	LPESFDGSLKTEAN	-5.70842	-6.74372
HLA-B52:01	3W39	5380	LPESFDGSLKTEAN	-6.83737	-6.95077
HLA-B52:01	3W39	5380	LPESFDGSLKTEAN	-4.4836	-5.5189
HLA-A11:01	4UQ2	5380	LPESFDGSLKTEAN	-10.0067	-10.1201
HLA-A11:01	4UQ2	5380	LPESFDGSLKTEAN	-9.03915	-10.0745
HLA-A24:02	5HGA	5380	LPESFDGSLKTEAN	-6.56204	-6.67544
HLA-A24:02	5HGA	5380	LPESFDGSLKTEAN	-5.42271	-6.45801
HLA-B44:05	3DX8	5380	LPESFDGSLKTEAN	-7.85648	-8.89178
HLA-B44:05	3DX8	5380	LPESFDGSLKTEAN	-5.3978	-5.5112
HLA-A02:01	6TDR	5380	LPESFDGSLKTEAN	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of ERBB2-TATDN1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ERBB2-TATDN1	chr17	37868701	chr8	125507783	5	15	FLPESFDGSL	ATTTCTGCCGGAGAGCTTTGATGGCTCACT
ERBB2-TATDN1	chr17	37868701	chr8	125507783	6	15	LPESFDGSL	TCTGCCGGAGAGCTTTGATGGCTCACT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
ERBB2-TATDN1	chr17	37868701	chr8	125507783	10	25	FDGSLKTEANLEVLK	CTTTGATGGCTCACTGAAAACTGAAGCTAATTTGGAAGTTTTGAA
ERBB2-TATDN1	chr17	37868701	chr8	125507783	11	26	DGSLKTEANLEVLKS	TGATGGCTCACTGAAAACTGAAGCTAATTTGGAAGTTTTGAAGTC

Top

Information of the samples that have these potential fusion neoantigens of ERBB2-TATDN1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BLCA	ERBB2-TATDN1	chr17	37868701	ENST00000269571	chr8	125507783	ENST00000276692	TCGA-DK-A2I6-01A

Top

Potential target of CAR-T therapy development for ERBB2-TATDN1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ERBB2-TATDN1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ERBB2-TATDN1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)