Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ETHE1-CEACAM1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ETHE1-CEACAM1
	FusionPDB ID: 27646
	FusionGDB2.0 ID: 27646
		Hgene	Tgene
	Gene symbol	ETHE1	CEACAM1
	Gene ID	23474	634
	Gene name	ETHE1 persulfide dioxygenase	CEA cell adhesion molecule 1
	Synonyms	HSCO\|YF13H12	BGP\|BGP1\|BGPI
	Cytomap	19q13.31	19q13.2
	Type of gene	protein-coding	protein-coding
	Description	persulfide dioxygenase ETHE1, mitochondrialethylmalonic encephalopathy 1hepatoma subtracted clone one proteinprotein ETHE1, mitochondrialsulfur dioxygenase ETHE1	carcinoembryonic antigen-related cell adhesion molecule 1CD66a antigenantigen CD66carcinoembryonic antigen related cell adhesion molecule 1carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)
	Modification date	20200313	20200313
	UniProtAcc	O95571 Main function of 5'-partner protein: FUNCTION: Sulfur dioxygenase that plays an essential role in hydrogen sulfide catabolism in the mitochondrial matrix. Hydrogen sulfide (H(2)S) is first oxidized by SQRDL, giving rise to cysteine persulfide residues. ETHE1 consumes molecular oxygen to catalyze the oxidation of the persulfide, once it has been transferred to a thiophilic acceptor, such as glutathione (R-SSH). Plays an important role in metabolic homeostasis in mitochondria by metabolizing hydrogen sulfide and preventing the accumulation of supraphysiological H(2)S levels that have toxic effects, due to the inhibition of cytochrome c oxidase. First described as a protein that can shuttle between the nucleus and the cytoplasm and suppress p53-induced apoptosis by sequestering the transcription factor RELA/NFKB3 in the cytoplasm and preventing its accumulation in the nucleus (PubMed:12398897). {ECO:0000269\|PubMed:12398897, ECO:0000269\|PubMed:14732903, ECO:0000269\|PubMed:19136963, ECO:0000269\|PubMed:23144459}.	P13688 Main function of 5'-partner protein: FUNCTION: [Isoform 1]: Cell adhesion protein that mediates homophilic cell adhesion in a calcium-independent manner (By similarity). Plays a role as coinhibitory receptor in immune response, insulin action and functions also as an activator during angiogenesis (PubMed:18424730, PubMed:23696226, PubMed:25363763). Its coinhibitory receptor function is phosphorylation- and PTPN6 -dependent, which in turn, suppress signal transduction of associated receptors by dephosphorylation of their downstream effectors. Plays a role in immune response, of T cells, natural killer (NK) and neutrophils (PubMed:18424730, PubMed:23696226). Upon TCR/CD3 complex stimulation, inhibits TCR-mediated cytotoxicity by blocking granule exocytosis by mediating homophilic binding to adjacent cells, allowing interaction with and phosphorylation by LCK and interaction with the TCR/CD3 complex which recruits PTPN6 resulting in dephosphorylation of CD247 and ZAP70 (PubMed:18424730). Also inhibits T cell proliferation and cytokine production through inhibition of JNK cascade and plays a crucial role in regulating autoimmunity and anti-tumor immunity by inhibiting T cell through its interaction with HAVCR2 (PubMed:25363763). Upon natural killer (NK) cells activation, inhibit KLRK1-mediated cytolysis of CEACAM1-bearing tumor cells by trans-homophilic interactions with CEACAM1 on the target cell and lead to cis-interaction between CEACAM1 and KLRK1, allowing PTPN6 recruitment and then VAV1 dephosphorylation (PubMed:23696226). Upon neutrophils activation negatively regulates IL1B production by recruiting PTPN6 to a SYK-TLR4-CEACAM1 complex, that dephosphorylates SYK, reducing the production of reactive oxygen species (ROS) and lysosome disruption, which in turn, reduces the activity of the inflammasome. Downregulates neutrophil production by acting as a coinhibitory receptor for CSF3R by downregulating the CSF3R-STAT3 pathway through recruitment of PTPN6 that dephosphorylates CSF3R (By similarity). Also regulates insulin action by promoting INS clearance and regulating lipogenesis in liver through regulating insulin signaling (By similarity). Upon INS stimulation, undergoes phosphorylation by INSR leading to INS clearance by increasing receptor-mediated insulin endocytosis. This inernalization promotes interaction with FASN leading to receptor-mediated insulin degradation and to reduction of FASN activity leading to negative regulation of fatty acid synthesis. INSR-mediated phosphorylation also provokes a down-regulation of cell proliferation through SHC1 interaction resulting in decrease coupling of SHC1 to the MAPK3/ERK1-MAPK1/ERK2 and phosphatidylinositol 3-kinase pathways (By similarity). Functions as activator in angiogenesis by promoting blood vessel remodeling through endothelial cell differentiation and migration and in arteriogenesis by increasing the number of collateral arteries and collateral vessel calibers after ischemia. Also regulates vascular permeability through the VEGFR2 signaling pathway resulting in control of nitric oxide production (By similarity). Downregulates cell growth in response to EGF through its interaction with SHC1 that mediates interaction with EGFR resulting in decrease coupling of SHC1 to the MAPK3/ERK1-MAPK1/ERK2 pathway (By similarity). Negatively regulates platelet aggregation by decreasing platelet adhesion on type I collagen through the GPVI-FcRgamma complex (By similarity). Inhibits cell migration and cell scattering through interaction with FLNA; interfers with the interaction of FLNA with RALA (PubMed:16291724). Mediates bile acid transport activity in a phosphorylation dependent manner (By similarity). Negatively regulates osteoclastogenesis (By similarity). {ECO:0000250\|UniProtKB:P16573, ECO:0000250\|UniProtKB:P31809, ECO:0000269\|PubMed:16291724, ECO:0000269\|PubMed:18424730, ECO:0000269\|PubMed:23696226, ECO:0000269\|PubMed:25363763}.; FUNCTION: [Isoform 8]: Cell adhesion protein that mediates homophilic cell adhesion in a calcium-independent manner (By similarity). Promotes populations of T cells regulating IgA production and secretion associated with control of the commensal microbiota and resistance to enteropathogens (By similarity). {ECO:0000250\|UniProtKB:P16573, ECO:0000250\|UniProtKB:P31809}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000292147, ENST00000600651,	ENST00000308072, ENST00000403444, ENST00000403461, ENST00000599389, ENST00000358394, ENST00000488639, ENST00000351134, ENST00000161559, ENST00000352591,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	10 X 7 X 8=560	3 X 2 X 3=18
	# samples	11	3
	** MAII score	log2(11/560*10)=-2.34792330342031 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(3/18*10)=0.736965594166206 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0
Fusion gene context	PubMed: ETHE1 [Title/Abstract] AND CEACAM1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ETHE1 [Title/Abstract] AND CEACAM1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ETHE1(44030353)-CEACAM1(43013380), # samples:1
Anticipated loss of major functional domain due to fusion event.	ETHE1-CEACAM1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ETHE1-CEACAM1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ETHE1-CEACAM1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ETHE1-CEACAM1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ETHE1-CEACAM1 seems lost the major protein functional domain in Hgene partner, which is a cell metabolism gene due to the frame-shifted ORF. ETHE1-CEACAM1 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. ETHE1-CEACAM1 seems lost the major protein functional domain in Tgene partner, which is a tumor suppressor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	ETHE1	GO:0006749	glutathione metabolic process	23144459
Hgene	ETHE1	GO:0070813	hydrogen sulfide metabolic process	23144459
Tgene	CEACAM1	GO:0001915	negative regulation of T cell mediated cytotoxicity	18424730
Tgene	CEACAM1	GO:0030334	regulation of cell migration	16291724
Tgene	CEACAM1	GO:0043318	negative regulation of cytotoxic T cell degranulation	18424730
Tgene	CEACAM1	GO:0044319	wound healing, spreading of cells	16291724
Tgene	CEACAM1	GO:0050860	negative regulation of T cell receptor signaling pathway	18424730

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:44030353/chr19:43013380)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ETHE1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across CEACAM1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000292147	ETHE1	chr19	44030353	-	ENST00000352591	CEACAM1	chr19	43013380	-	2367	442	67	561	164
ENST00000292147	ETHE1	chr19	44030353	-	ENST00000161559	CEACAM1	chr19	43013380	-	2365	442	67	561	164
ENST00000600651	ETHE1	chr19	44030353	-	ENST00000352591	CEACAM1	chr19	43013380	-	2324	399	24	518	164
ENST00000600651	ETHE1	chr19	44030353	-	ENST00000161559	CEACAM1	chr19	43013380	-	2322	399	24	518	164

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000292147	ENST00000352591	ETHE1	chr19	44030353	-	CEACAM1	chr19	43013380	-	0.02555488	0.9744451
ENST00000292147	ENST00000161559	ETHE1	chr19	44030353	-	CEACAM1	chr19	43013380	-	0.026005724	0.9739943
ENST00000600651	ENST00000352591	ETHE1	chr19	44030353	-	CEACAM1	chr19	43013380	-	0.016139222	0.98386085
ENST00000600651	ENST00000161559	ETHE1	chr19	44030353	-	CEACAM1	chr19	43013380	-	0.016488949	0.9835111

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ETHE1-CEACAM1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ETHE1	chr19	44030353	CEACAM1	chr19	43013380	399	125	HIEDGDSIRFGRFMNEVTYSTLNFEA
ETHE1	chr19	44030353	CEACAM1	chr19	43013380	442	125	HIEDGDSIRFGRFMNEVTYSTLNFEA

Top

Potential FusionNeoAntigen Information of ETHE1-CEACAM1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ETHE1-CEACAM1_44030353_43013380.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B27:04	GRFMNEVTY	0.9997	0.7387	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B27:05	GRFMNEVTY	0.9997	0.9003	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B27:02	GRFMNEVTY	0.9997	0.6188	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:22	FMNEVTYST	0.9966	0.6463	12	21
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:11	FMNEVTYST	0.9962	0.6091	12	21
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:67	FMNEVTYST	0.996	0.5738	12	21
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:30	FMNEVTYST	0.996	0.5738	12	21
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:24	FMNEVTYST	0.996	0.5738	12	21
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:60	FMNEVTYST	0.9958	0.547	12	21
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:21	FMNEVTYST	0.9947	0.7001	12	21
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:16	FMNEVTYST	0.9932	0.5607	12	21
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:27	FMNEVTYST	0.9929	0.6554	12	21
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:13	FMNEVTYST	0.9895	0.7267	12	21
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:35	FMNEVTYST	0.9856	0.6134	12	21
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:38	FMNEVTYST	0.9842	0.5689	12	21
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:29	FMNEVTYST	0.9809	0.5822	12	21
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:04	FMNEVTYST	0.98	0.5934	12	21
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:20	FMNEVTYST	0.9708	0.579	12	21
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B47:01	GRFMNEVTY	0.6785	0.6538	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B15:03	GRFMNEVTY	0.3705	0.8036	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B15:18	GRFMNEVTY	0.2828	0.7531	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:22	FMNEVTYSTL	0.9984	0.7072	12	22
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:67	FMNEVTYSTL	0.9974	0.639	12	22
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:24	FMNEVTYSTL	0.9974	0.639	12	22
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:30	FMNEVTYSTL	0.9974	0.639	12	22
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:60	FMNEVTYSTL	0.9972	0.6289	12	22
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:11	FMNEVTYSTL	0.9971	0.6795	12	22
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:27	FMNEVTYSTL	0.9961	0.7332	12	22
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:13	FMNEVTYSTL	0.9945	0.8081	12	22
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B27:04	FGRFMNEVTY	0.9939	0.7736	9	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:04	FMNEVTYSTL	0.9937	0.7052	12	22
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:16	FMNEVTYSTL	0.9937	0.5944	12	22
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B27:05	FGRFMNEVTY	0.9934	0.9107	9	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B27:02	FGRFMNEVTY	0.9919	0.6338	9	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:19	FMNEVTYSTL	0.9892	0.5005	12	22
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:38	FMNEVTYSTL	0.9872	0.6452	12	22
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:29	FMNEVTYSTL	0.9861	0.6479	12	22
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:35	FMNEVTYSTL	0.9841	0.6723	12	22
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:20	FMNEVTYSTL	0.9754	0.6433	12	22
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B15:18	FGRFMNEVTY	0.9292	0.8129	9	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B27:02	RFGRFMNEVTY	0.9986	0.6505	8	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B27:04	RFGRFMNEVTY	0.9985	0.7072	8	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B27:05	RFGRFMNEVTY	0.9984	0.9305	8	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B27:14	GRFMNEVTY	0.9975	0.8189	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B27:03	GRFMNEVTY	0.9968	0.9131	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:02	FMNEVTYST	0.9963	0.5541	12	21
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:01	FMNEVTYST	0.996	0.5738	12	21
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:07	FMNEVTYST	0.9959	0.6017	12	21
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:05	FMNEVTYST	0.995	0.6976	12	21
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C07:95	GRFMNEVTY	0.993	0.6751	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C07:27	GRFMNEVTY	0.9889	0.9485	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C07:05	GRFMNEVTY	0.9851	0.9493	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C07:19	GRFMNEVTY	0.8595	0.5905	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C07:46	GRFMNEVTY	0.8261	0.8374	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C07:67	GRFMNEVTY	0.8251	0.9258	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C07:80	GRFMNEVTY	0.8251	0.9258	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C07:10	GRFMNEVTY	0.8199	0.9241	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C12:16	GRFMNEVTY	0.0808	0.9601	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:02	FMNEVTYSTL	0.9985	0.6379	12	22
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:05	FMNEVTYSTL	0.9978	0.7805	12	22
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:07	FMNEVTYSTL	0.9975	0.6356	12	22
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:01	FMNEVTYSTL	0.9974	0.639	12	22
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B27:03	FGRFMNEVTY	0.8931	0.92	9	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C07:19	FGRFMNEVTY	0.8824	0.7809	9	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C07:95	FGRFMNEVTY	0.8747	0.7483	9	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C07:27	FGRFMNEVTY	0.8698	0.9623	9	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C07:67	FGRFMNEVTY	0.8588	0.9599	9	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C07:80	FGRFMNEVTY	0.8588	0.9599	9	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C07:46	FGRFMNEVTY	0.8517	0.9103	9	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C07:10	FGRFMNEVTY	0.8491	0.9584	9	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B27:14	RFGRFMNEVTY	0.9966	0.8482	8	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B27:03	RFGRFMNEVTY	0.9808	0.941	8	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C07:46	RFGRFMNEVTY	0.8828	0.8648	8	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C14:02	RFMNEVTY	0.5075	0.9445	11	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C14:03	RFMNEVTY	0.5075	0.9445	11	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B27:10	GRFMNEVTY	0.9997	0.8755	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B27:08	GRFMNEVTY	0.9996	0.7791	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B27:06	GRFMNEVTY	0.9978	0.7355	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C07:01	GRFMNEVTY	0.995	0.6204	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:03	FMNEVTYST	0.995	0.7776	12	21
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:06	FMNEVTYST	0.9947	0.7001	12	21
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:14	FMNEVTYST	0.9944	0.645	12	21
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B27:09	GRFMNEVTY	0.9885	0.8394	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C07:17	GRFMNEVTY	0.959	0.957	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C07:02	GRFMNEVTY	0.8251	0.9258	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C07:22	GRFMNEVTY	0.791	0.6204	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C06:08	GRFMNEVTY	0.4846	0.9926	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B48:02	GRFMNEVTY	0.2935	0.9284	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B15:53	GRFMNEVTY	0.1546	0.8911	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B15:54	GRFMNEVTY	0.1064	0.8713	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C06:02	GRFMNEVTY	0.018	0.9925	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C06:17	GRFMNEVTY	0.018	0.9925	10	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-A02:03	FMNEVTYSTL	0.9979	0.8161	12	22
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B27:10	FGRFMNEVTY	0.9941	0.8982	9	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B15:30	FMNEVTYSTL	0.9931	0.9143	12	22
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B27:08	FGRFMNEVTY	0.9907	0.7811	9	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C07:22	FGRFMNEVTY	0.9343	0.7353	9	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C07:01	FGRFMNEVTY	0.889	0.6902	9	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C07:17	FGRFMNEVTY	0.8742	0.968	9	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-C07:02	FGRFMNEVTY	0.8588	0.9599	9	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B27:10	RFGRFMNEVTY	0.9985	0.8809	8	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B27:08	RFGRFMNEVTY	0.998	0.8281	8	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B27:09	RFGRFMNEVTY	0.966	0.8771	8	19
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	442	HLA-B15:68	RFGRFMNEVTY	0.7805	0.5994	8	19

Top

Potential FusionNeoAntigen Information of ETHE1-CEACAM1 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of ETHE1-CEACAM1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
8670	SIRFGRFMNEVTYS	ETHE1	CEACAM1	chr19	44030353	chr19	43013380	442

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ETHE1-CEACAM1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	8670	SIRFGRFMNEVTYS	-7.9962	-8.1096
HLA-B14:02	3BVN	8670	SIRFGRFMNEVTYS	-5.70842	-6.74372
HLA-B52:01	3W39	8670	SIRFGRFMNEVTYS	-6.83737	-6.95077
HLA-B52:01	3W39	8670	SIRFGRFMNEVTYS	-4.4836	-5.5189
HLA-A11:01	4UQ2	8670	SIRFGRFMNEVTYS	-10.0067	-10.1201
HLA-A11:01	4UQ2	8670	SIRFGRFMNEVTYS	-9.03915	-10.0745
HLA-A24:02	5HGA	8670	SIRFGRFMNEVTYS	-6.56204	-6.67544
HLA-A24:02	5HGA	8670	SIRFGRFMNEVTYS	-5.42271	-6.45801
HLA-B44:05	3DX8	8670	SIRFGRFMNEVTYS	-7.85648	-8.89178
HLA-B44:05	3DX8	8670	SIRFGRFMNEVTYS	-5.3978	-5.5112
HLA-A02:01	6TDR	8670	SIRFGRFMNEVTYS	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of ETHE1-CEACAM1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	10	19	GRFMNEVTY	GGGCGCTTCATGAATGAAGTTACTTAT
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	11	19	RFMNEVTY	CGCTTCATGAATGAAGTTACTTAT
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	12	21	FMNEVTYST	TTCATGAATGAAGTTACTTATTCTACC
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	12	22	FMNEVTYSTL	TTCATGAATGAAGTTACTTATTCTACCCTG
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	8	19	RFGRFMNEVTY	CGCTTCGGGCGCTTCATGAATGAAGTTACTTAT
ETHE1-CEACAM1	chr19	44030353	chr19	43013380	9	19	FGRFMNEVTY	TTCGGGCGCTTCATGAATGAAGTTACTTAT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of ETHE1-CEACAM1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
Non-Cancer	ETHE1-CEACAM1	chr19	44030353	ENST00000292147	chr19	43013380	ENST00000161559	TCGA-CG-5734-11A

Top

Potential target of CAR-T therapy development for ETHE1-CEACAM1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Tgene

CEACAM1

chr19:44030353

chr19:43013380

ENST00000351134

429_452

253.0

Transmembrane

Helical

Tgene

CEACAM1

chr19:44030353

chr19:43013380

ENST00000352591

429_452

431.0

Transmembrane

Helical

Tgene

CEACAM1

chr19:44030353

chr19:43013380

ENST00000358394

429_452

462.0

Transmembrane

Helical

Tgene

CEACAM1

chr19:44030353

chr19:43013380

ENST00000403461

429_452

282.0

Transmembrane

Helical

Tgene

CEACAM1

chr19:44030353

chr19:43013380

ENST00000599389

429_452

241.0

Transmembrane

Helical

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ETHE1-CEACAM1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ETHE1-CEACAM1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)