Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:EVI5L-VAV1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: EVI5L-VAV1
	FusionPDB ID: 27790
	FusionGDB2.0 ID: 27790
		Hgene	Tgene
	Gene symbol	EVI5L	VAV1
	Gene ID	115704	7409
	Gene name	ecotropic viral integration site 5 like	vav guanine nucleotide exchange factor 1
	Synonyms	-	VAV
	Cytomap	19p13.2	19p13.3
	Type of gene	protein-coding	protein-coding
	Description	EVI5-like proteinecotropic viral integration site 5-like proteinepididymis secretory sperm binding protein	proto-oncogene vavvav 1 guanine nucleotide exchange factorvav 1 oncogene
	Modification date	20200313	20200313
	UniProtAcc	Q96CN4 Main function of 5'-partner protein: FUNCTION: Functions as a GTPase-activating protein (GAP) with a broad specificity. {ECO:0000269\|PubMed:16923123}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000600802, ENST00000270530, ENST00000538904,	ENST00000304076, ENST00000539284, ENST00000596764, ENST00000599806, ENST00000602142,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	3 X 3 X 3=27	10 X 11 X 8=880
	# samples	4	12
	** MAII score	log2(4/27*10)=0.567040592723894 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0	log2(12/880*10)=-2.87446911791614 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: EVI5L [Title/Abstract] AND VAV1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: EVI5L [Title/Abstract] AND VAV1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	EVI5L(7923217)-VAV1(6843146), # samples:2
Anticipated loss of major functional domain due to fusion event.	EVI5L-VAV1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EVI5L-VAV1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EVI5L-VAV1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. EVI5L-VAV1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	EVI5L	GO:0043547	positive regulation of GTPase activity	17646400

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:7923217/chr19:6843146)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across EVI5L (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across VAV1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000270530	EVI5L	chr19	7923217	+	ENST00000304076	VAV1	chr19	6843146	+	2354	1537	196	2094	632
ENST00000270530	EVI5L	chr19	7923217	+	ENST00000602142	VAV1	chr19	6843146	+	2095	1537	196	2094	633
ENST00000270530	EVI5L	chr19	7923217	+	ENST00000596764	VAV1	chr19	6843146	+	2348	1537	196	2094	632
ENST00000270530	EVI5L	chr19	7923217	+	ENST00000539284	VAV1	chr19	6843146	+	2348	1537	196	2094	632
ENST00000270530	EVI5L	chr19	7923217	+	ENST00000599806	VAV1	chr19	6843146	+	2354	1537	196	2094	632
ENST00000538904	EVI5L	chr19	7923217	+	ENST00000304076	VAV1	chr19	6843146	+	2191	1374	0	1931	643
ENST00000538904	EVI5L	chr19	7923217	+	ENST00000602142	VAV1	chr19	6843146	+	1932	1374	0	1931	643
ENST00000538904	EVI5L	chr19	7923217	+	ENST00000596764	VAV1	chr19	6843146	+	2185	1374	0	1931	643
ENST00000538904	EVI5L	chr19	7923217	+	ENST00000539284	VAV1	chr19	6843146	+	2185	1374	0	1931	643
ENST00000538904	EVI5L	chr19	7923217	+	ENST00000599806	VAV1	chr19	6843146	+	2191	1374	0	1931	643
ENST00000270530	EVI5L	chr19	7923217	+	ENST00000304076	VAV1	chr19	6843145	+	2354	1537	196	2094	632
ENST00000270530	EVI5L	chr19	7923217	+	ENST00000602142	VAV1	chr19	6843145	+	2095	1537	196	2094	633
ENST00000270530	EVI5L	chr19	7923217	+	ENST00000596764	VAV1	chr19	6843145	+	2348	1537	196	2094	632
ENST00000270530	EVI5L	chr19	7923217	+	ENST00000539284	VAV1	chr19	6843145	+	2348	1537	196	2094	632
ENST00000270530	EVI5L	chr19	7923217	+	ENST00000599806	VAV1	chr19	6843145	+	2354	1537	196	2094	632
ENST00000538904	EVI5L	chr19	7923217	+	ENST00000304076	VAV1	chr19	6843145	+	2191	1374	0	1931	643
ENST00000538904	EVI5L	chr19	7923217	+	ENST00000602142	VAV1	chr19	6843145	+	1932	1374	0	1931	643
ENST00000538904	EVI5L	chr19	7923217	+	ENST00000596764	VAV1	chr19	6843145	+	2185	1374	0	1931	643
ENST00000538904	EVI5L	chr19	7923217	+	ENST00000539284	VAV1	chr19	6843145	+	2185	1374	0	1931	643
ENST00000538904	EVI5L	chr19	7923217	+	ENST00000599806	VAV1	chr19	6843145	+	2191	1374	0	1931	643

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000270530	ENST00000304076	EVI5L	chr19	7923217	+	VAV1	chr19	6843146	+	0.015747055	0.984253
ENST00000270530	ENST00000602142	EVI5L	chr19	7923217	+	VAV1	chr19	6843146	+	0.014798961	0.9852011
ENST00000270530	ENST00000596764	EVI5L	chr19	7923217	+	VAV1	chr19	6843146	+	0.015855879	0.9841441
ENST00000270530	ENST00000539284	EVI5L	chr19	7923217	+	VAV1	chr19	6843146	+	0.015855879	0.9841441
ENST00000270530	ENST00000599806	EVI5L	chr19	7923217	+	VAV1	chr19	6843146	+	0.015747055	0.984253
ENST00000538904	ENST00000304076	EVI5L	chr19	7923217	+	VAV1	chr19	6843146	+	0.01705286	0.9829472
ENST00000538904	ENST00000602142	EVI5L	chr19	7923217	+	VAV1	chr19	6843146	+	0.01768631	0.9823137
ENST00000538904	ENST00000596764	EVI5L	chr19	7923217	+	VAV1	chr19	6843146	+	0.017125562	0.9828744
ENST00000538904	ENST00000539284	EVI5L	chr19	7923217	+	VAV1	chr19	6843146	+	0.017125562	0.9828744
ENST00000538904	ENST00000599806	EVI5L	chr19	7923217	+	VAV1	chr19	6843146	+	0.01705286	0.9829472
ENST00000270530	ENST00000304076	EVI5L	chr19	7923217	+	VAV1	chr19	6843145	+	0.015747055	0.984253
ENST00000270530	ENST00000602142	EVI5L	chr19	7923217	+	VAV1	chr19	6843145	+	0.014798961	0.9852011
ENST00000270530	ENST00000596764	EVI5L	chr19	7923217	+	VAV1	chr19	6843145	+	0.015855879	0.9841441
ENST00000270530	ENST00000539284	EVI5L	chr19	7923217	+	VAV1	chr19	6843145	+	0.015855879	0.9841441
ENST00000270530	ENST00000599806	EVI5L	chr19	7923217	+	VAV1	chr19	6843145	+	0.015747055	0.984253
ENST00000538904	ENST00000304076	EVI5L	chr19	7923217	+	VAV1	chr19	6843145	+	0.01705286	0.9829472
ENST00000538904	ENST00000602142	EVI5L	chr19	7923217	+	VAV1	chr19	6843145	+	0.01768631	0.9823137
ENST00000538904	ENST00000596764	EVI5L	chr19	7923217	+	VAV1	chr19	6843145	+	0.017125562	0.9828744
ENST00000538904	ENST00000539284	EVI5L	chr19	7923217	+	VAV1	chr19	6843145	+	0.017125562	0.9828744
ENST00000538904	ENST00000599806	EVI5L	chr19	7923217	+	VAV1	chr19	6843145	+	0.01705286	0.9829472

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for EVI5L-VAV1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
EVI5L	chr19	7923217	VAV1	chr19	6843145	1374	458	KAQSTIRQLQEQQGPPQDLSVHLWYA
EVI5L	chr19	7923217	VAV1	chr19	6843145	1537	447	KAQSTIRQLQEQQGPPQDLSVHLWYA
EVI5L	chr19	7923217	VAV1	chr19	6843146	1374	458	KAQSTIRQLQEQQGPPQDLSVHLWYA
EVI5L	chr19	7923217	VAV1	chr19	6843146	1537	447	KAQSTIRQLQEQQGPPQDLSVHLWYA

Top

Potential FusionNeoAntigen Information of EVI5L-VAV1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

EVI5L-VAV1_7923217_6843145.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B39:01	EQQGPPQDL	0.8678	0.9846	10	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B39:13	EQQGPPQDL	0.7686	0.9919	10	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B38:02	EQQGPPQDL	0.7427	0.9933	10	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B38:01	EQQGPPQDL	0.7217	0.9922	10	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B15:10	EQQGPPQDL	0.6102	0.6684	10	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B15:37	EQQGPPQDL	0.5522	0.7706	10	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B40:01	QEQQGPPQDL	0.9036	0.5873	9	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B44:03	QEQQGPPQDL	0.7527	0.9752	9	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B44:05	QEQQGPPQDL	0.7447	0.6894	9	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B41:02	QEQQGPPQDL	0.6757	0.7208	9	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B39:13	QEQQGPPQDL	0.6144	0.9924	9	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B13:02	QQGPPQDLSV	0.5957	0.7728	11	21
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B39:09	EQQGPPQDL	0.8962	0.9298	10	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-C01:17	QGPPQDLSV	0.7973	0.9506	12	21
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B39:05	EQQGPPQDL	0.7434	0.982	10	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B39:08	EQQGPPQDL	0.6176	0.9753	10	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B14:03	EQQGPPQDL	0.5211	0.9394	10	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B48:03	QEQQGPPQDL	0.8849	0.5879	9	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B39:08	QEQQGPPQDL	0.8309	0.9765	9	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B44:09	QEQQGPPQDL	0.8091	0.6901	9	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B44:10	QEQQGPPQDL	0.7957	0.8324	9	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B44:08	QEQQGPPQDL	0.7474	0.5493	9	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B39:10	QGPPQDLSVHL	0.8694	0.7453	12	23
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-C01:03	QGPPQDLSV	0.9333	0.9507	12	21
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B39:02	EQQGPPQDL	0.8894	0.9923	10	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B39:31	EQQGPPQDL	0.8893	0.9842	10	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-C01:02	QGPPQDLSV	0.8313	0.9529	12	21
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B38:05	EQQGPPQDL	0.7217	0.9922	10	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B39:11	EQQGPPQDL	0.591	0.9602	10	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B15:09	EQQGPPQDL	0.4454	0.6698	10	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B40:04	QEQQGPPQDL	0.932	0.8932	9	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B40:36	QEQQGPPQDL	0.9011	0.5897	9	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B40:12	QEQQGPPQDL	0.8849	0.5879	9	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B40:49	QEQQGPPQDL	0.8834	0.5897	9	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B44:26	QEQQGPPQDL	0.7527	0.9752	9	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B44:07	QEQQGPPQDL	0.7527	0.9752	9	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B44:13	QEQQGPPQDL	0.7527	0.9752	9	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B41:03	QEQQGPPQDL	0.4664	0.9019	9	19
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	HLA-B67:01	QGPPQDLSVHL	0.8675	0.6911	12	23

Top

Potential FusionNeoAntigen Information of EVI5L-VAV1 in HLA II

EVI5L-VAV1_7923217_6843145.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-0415	QSTIRQLQEQQGPPQ	2	17
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-0436	QSTIRQLQEQQGPPQ	2	17
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-0442	QSTIRQLQEQQGPPQ	2	17
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1002	QSTIRQLQEQQGPPQ	2	17
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1203	QSTIRQLQEQQGPPQ	2	17
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1204	QSTIRQLQEQQGPPQ	2	17
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1204	AQSTIRQLQEQQGPP	1	16
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1209	QSTIRQLQEQQGPPQ	2	17
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1209	AQSTIRQLQEQQGPP	1	16
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1212	QSTIRQLQEQQGPPQ	2	17
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1213	QSTIRQLQEQQGPPQ	2	17
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1213	AQSTIRQLQEQQGPP	1	16
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1215	QSTIRQLQEQQGPPQ	2	17
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1215	AQSTIRQLQEQQGPP	1	16
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1216	QSTIRQLQEQQGPPQ	2	17
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1218	QSTIRQLQEQQGPPQ	2	17
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1218	AQSTIRQLQEQQGPP	1	16
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1219	QSTIRQLQEQQGPPQ	2	17
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1219	AQSTIRQLQEQQGPP	1	16
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1220	QSTIRQLQEQQGPPQ	2	17
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1220	AQSTIRQLQEQQGPP	1	16
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1220	KAQSTIRQLQEQQGP	0	15
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1220	STIRQLQEQQGPPQD	3	18
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1221	QSTIRQLQEQQGPPQ	2	17
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1221	AQSTIRQLQEQQGPP	1	16
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1223	QSTIRQLQEQQGPPQ	2	17
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1223	AQSTIRQLQEQQGPP	1	16
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1503	QSTIRQLQEQQGPPQ	2	17
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1503	AQSTIRQLQEQQGPP	1	16
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1523	QSTIRQLQEQQGPPQ	2	17
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1523	AQSTIRQLQEQQGPP	1	16
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1523	KAQSTIRQLQEQQGP	0	15
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1523	STIRQLQEQQGPPQD	3	18
EVI5L-VAV1	chr19	7923217	chr19	6843145	1537	DRB1-1615	QSTIRQLQEQQGPPQ	2	17

Top

Fusion breakpoint peptide structures of EVI5L-VAV1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
8132	RQLQEQQGPPQDLS	EVI5L	VAV1	chr19	7923217	chr19	6843145	1537

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of EVI5L-VAV1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	8132	RQLQEQQGPPQDLS	-7.15543	-7.26883
HLA-B14:02	3BVN	8132	RQLQEQQGPPQDLS	-4.77435	-5.80965
HLA-B52:01	3W39	8132	RQLQEQQGPPQDLS	-6.80875	-6.92215
HLA-B52:01	3W39	8132	RQLQEQQGPPQDLS	-4.20386	-5.23916
HLA-A11:01	4UQ2	8132	RQLQEQQGPPQDLS	-7.5194	-8.5547
HLA-A11:01	4UQ2	8132	RQLQEQQGPPQDLS	-6.9601	-7.0735
HLA-A24:02	5HGA	8132	RQLQEQQGPPQDLS	-7.52403	-7.63743
HLA-A24:02	5HGA	8132	RQLQEQQGPPQDLS	-5.82433	-6.85963
HLA-B27:05	6PYJ	8132	RQLQEQQGPPQDLS	-3.28285	-4.31815
HLA-B44:05	3DX8	8132	RQLQEQQGPPQDLS	-5.91172	-6.94702
HLA-B44:05	3DX8	8132	RQLQEQQGPPQDLS	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of EVI5L-VAV1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
EVI5L-VAV1	chr19	7923217	chr19	6843145	10	19	EQQGPPQDL	GAGCAGCAGGGCCCTCCTCAGGACCTG
EVI5L-VAV1	chr19	7923217	chr19	6843145	11	21	QQGPPQDLSV	CAGCAGGGCCCTCCTCAGGACCTGTCTGTT
EVI5L-VAV1	chr19	7923217	chr19	6843145	12	21	QGPPQDLSV	CAGGGCCCTCCTCAGGACCTGTCTGTT
EVI5L-VAV1	chr19	7923217	chr19	6843145	12	23	QGPPQDLSVHL	CAGGGCCCTCCTCAGGACCTGTCTGTTCATCTC
EVI5L-VAV1	chr19	7923217	chr19	6843145	9	19	QEQQGPPQDL	CAGGAGCAGCAGGGCCCTCCTCAGGACCTG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
EVI5L-VAV1	chr19	7923217	chr19	6843145	0	15	KAQSTIRQLQEQQGP	AAGGCACAGAGCACCATCCGGCAGCTACAGGAGCAGCAGGGCCCT
EVI5L-VAV1	chr19	7923217	chr19	6843145	1	16	AQSTIRQLQEQQGPP	GCACAGAGCACCATCCGGCAGCTACAGGAGCAGCAGGGCCCTCCT
EVI5L-VAV1	chr19	7923217	chr19	6843145	2	17	QSTIRQLQEQQGPPQ	CAGAGCACCATCCGGCAGCTACAGGAGCAGCAGGGCCCTCCTCAG
EVI5L-VAV1	chr19	7923217	chr19	6843145	3	18	STIRQLQEQQGPPQD	AGCACCATCCGGCAGCTACAGGAGCAGCAGGGCCCTCCTCAGGAC

Top

Information of the samples that have these potential fusion neoantigens of EVI5L-VAV1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	EVI5L-VAV1	chr19	7923217	ENST00000270530	chr19	6843145	ENST00000304076	TCGA-AQ-A54N

Top

Potential target of CAR-T therapy development for EVI5L-VAV1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to EVI5L-VAV1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to EVI5L-VAV1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)