![]() |
|||||||
|
Fusion Protein:AGAP1-WDR11 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: AGAP1-WDR11 | FusionPDB ID: 2803 | FusionGDB2.0 ID: 2803 | Hgene | Tgene | Gene symbol | AGAP1 | WDR11 | Gene ID | 116987 | 55717 |
Gene name | ArfGAP with GTPase domain, ankyrin repeat and PH domain 1 | WD repeat domain 11 | |
Synonyms | AGAP-1|CENTG2|GGAP1|cnt-g2 | BRWD2|DR11|HH14|SRI1|WDR15 | |
Cytomap | 2q37.2 | 10q26.12 | |
Type of gene | protein-coding | protein-coding | |
Description | arf-GAP with GTPase, ANK repeat and PH domain-containing protein 1Arf GAP with GTP-binding protein-like, ANK repeat and PH domains 1GTP-binding and GTPase-activating protein 1centaurin, gamma 2 | WD repeat-containing protein 11WD repeat domain 15WD repeat-containing protein 15bromodomain and WD repeat-containing protein 2sensitization to ricin complex subunit 1 | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | Q9UPQ3 Main function of 5'-partner protein: FUNCTION: GTPase-activating protein for ARF1 and, to a lesser extent, ARF5. Directly and specifically regulates the adapter protein 3 (AP-3)-dependent trafficking of proteins in the endosomal-lysosomal system. {ECO:0000269|PubMed:12640130}. | . | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000304032, ENST00000336665, ENST00000409457, ENST00000409538, ENST00000428334, | ENST00000604509, ENST00000263461, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 49 X 18 X 17=14994 | 3 X 3 X 1=9 |
# samples | 48 | 4 | |
** MAII score | log2(48/14994*10)=-4.96520709119934 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(4/9*10)=2.15200309344505 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | |
Fusion gene context | PubMed: AGAP1 [Title/Abstract] AND WDR11 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: AGAP1 [Title/Abstract] AND WDR11 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | AGAP1(236403493)-WDR11(122659541), # samples:3 | ||
Anticipated loss of major functional domain due to fusion event. | AGAP1-WDR11 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. AGAP1-WDR11 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Tgene | WDR11 | GO:0006886 | intracellular protein transport | 29426865 |
Tgene | WDR11 | GO:0099041 | vesicle tethering to Golgi | 29426865 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:236403493/chr10:122659541) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000336665 | AGAP1 | chr2 | 236403493 | + | ENST00000263461 | WDR11 | chr10 | 122659541 | + | 2714 | 743 | 421 | 1902 | 493 |
ENST00000304032 | AGAP1 | chr2 | 236403493 | + | ENST00000263461 | WDR11 | chr10 | 122659541 | + | 2714 | 743 | 421 | 1902 | 493 |
ENST00000409457 | AGAP1 | chr2 | 236403493 | + | ENST00000263461 | WDR11 | chr10 | 122659541 | + | 2732 | 761 | 439 | 1920 | 493 |
ENST00000336665 | AGAP1 | chr2 | 236403493 | + | ENST00000263461 | WDR11 | chr10 | 122659540 | + | 2714 | 743 | 421 | 1902 | 493 |
ENST00000304032 | AGAP1 | chr2 | 236403493 | + | ENST00000263461 | WDR11 | chr10 | 122659540 | + | 2714 | 743 | 421 | 1902 | 493 |
ENST00000409457 | AGAP1 | chr2 | 236403493 | + | ENST00000263461 | WDR11 | chr10 | 122659540 | + | 2732 | 761 | 439 | 1920 | 493 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000336665 | ENST00000263461 | AGAP1 | chr2 | 236403493 | + | WDR11 | chr10 | 122659541 | + | 0.001568244 | 0.99843174 |
ENST00000304032 | ENST00000263461 | AGAP1 | chr2 | 236403493 | + | WDR11 | chr10 | 122659541 | + | 0.001568244 | 0.99843174 |
ENST00000409457 | ENST00000263461 | AGAP1 | chr2 | 236403493 | + | WDR11 | chr10 | 122659541 | + | 0.00163521 | 0.99836475 |
ENST00000336665 | ENST00000263461 | AGAP1 | chr2 | 236403493 | + | WDR11 | chr10 | 122659540 | + | 0.001568244 | 0.99843174 |
ENST00000304032 | ENST00000263461 | AGAP1 | chr2 | 236403493 | + | WDR11 | chr10 | 122659540 | + | 0.001568244 | 0.99843174 |
ENST00000409457 | ENST00000263461 | AGAP1 | chr2 | 236403493 | + | WDR11 | chr10 | 122659540 | + | 0.00163521 | 0.99836475 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for AGAP1-WDR11 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
AGAP1 | chr2 | 236403493 | WDR11 | chr10 | 122659540 | 743 | 102 | VEEPVLQNQIREHVIAIEEPVWCPYL |
AGAP1 | chr2 | 236403493 | WDR11 | chr10 | 122659540 | 761 | 102 | VEEPVLQNQIREHVIAIEEPVWCPYL |
AGAP1 | chr2 | 236403493 | WDR11 | chr10 | 122659541 | 743 | 102 | VEEPVLQNQIREHVIAIEEPVWCPYL |
AGAP1 | chr2 | 236403493 | WDR11 | chr10 | 122659541 | 761 | 102 | VEEPVLQNQIREHVIAIEEPVWCPYL |
Top |
Potential FusionNeoAntigen Information of AGAP1-WDR11 in HLA I |
![]() |
AGAP1-WDR11_236403493_122659540.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
AGAP1-WDR11 | chr2 | 236403493 | chr10 | 122659540 | 743 | HLA-B08:09 | QIREHVIAI | 0.9922 | 0.6151 | 8 | 17 |
AGAP1-WDR11 | chr2 | 236403493 | chr10 | 122659540 | 743 | HLA-B39:06 | EHVIAIEEP | 0.9745 | 0.856 | 11 | 20 |
AGAP1-WDR11 | chr2 | 236403493 | chr10 | 122659540 | 743 | HLA-B39:06 | NQIREHVIA | 0.9679 | 0.847 | 7 | 16 |
AGAP1-WDR11 | chr2 | 236403493 | chr10 | 122659540 | 743 | HLA-A30:08 | QIREHVIAI | 0.9511 | 0.8073 | 8 | 17 |
AGAP1-WDR11 | chr2 | 236403493 | chr10 | 122659540 | 743 | HLA-B57:01 | HVIAIEEPVW | 0.9996 | 0.9954 | 12 | 22 |
AGAP1-WDR11 | chr2 | 236403493 | chr10 | 122659540 | 743 | HLA-B58:01 | HVIAIEEPVW | 0.9989 | 0.9886 | 12 | 22 |
AGAP1-WDR11 | chr2 | 236403493 | chr10 | 122659540 | 743 | HLA-B53:01 | HVIAIEEPVW | 0.9679 | 0.5623 | 12 | 22 |
AGAP1-WDR11 | chr2 | 236403493 | chr10 | 122659540 | 743 | HLA-B57:03 | HVIAIEEPVW | 0.9429 | 0.9972 | 12 | 22 |
AGAP1-WDR11 | chr2 | 236403493 | chr10 | 122659540 | 743 | HLA-B15:04 | QIREHVIAI | 0.9846 | 0.9551 | 8 | 17 |
AGAP1-WDR11 | chr2 | 236403493 | chr10 | 122659540 | 743 | HLA-A02:05 | HVIAIEEPV | 0.9752 | 0.5118 | 12 | 21 |
AGAP1-WDR11 | chr2 | 236403493 | chr10 | 122659540 | 743 | HLA-A68:02 | HVIAIEEPV | 0.9982 | 0.7 | 12 | 21 |
AGAP1-WDR11 | chr2 | 236403493 | chr10 | 122659540 | 743 | HLA-A69:01 | HVIAIEEPV | 0.9955 | 0.9111 | 12 | 21 |
AGAP1-WDR11 | chr2 | 236403493 | chr10 | 122659540 | 743 | HLA-A02:03 | QIREHVIAI | 0.9807 | 0.6311 | 8 | 17 |
AGAP1-WDR11 | chr2 | 236403493 | chr10 | 122659540 | 743 | HLA-B15:73 | QIREHVIAI | 0.98 | 0.8969 | 8 | 17 |
AGAP1-WDR11 | chr2 | 236403493 | chr10 | 122659540 | 743 | HLA-B15:30 | QIREHVIAI | 0.9682 | 0.9505 | 8 | 17 |
AGAP1-WDR11 | chr2 | 236403493 | chr10 | 122659540 | 743 | HLA-B57:10 | HVIAIEEPVW | 0.9996 | 0.9954 | 12 | 22 |
AGAP1-WDR11 | chr2 | 236403493 | chr10 | 122659540 | 743 | HLA-B57:04 | HVIAIEEPVW | 0.9983 | 0.8378 | 12 | 22 |
AGAP1-WDR11 | chr2 | 236403493 | chr10 | 122659540 | 743 | HLA-B57:02 | HVIAIEEPVW | 0.9827 | 0.9785 | 12 | 22 |
AGAP1-WDR11 | chr2 | 236403493 | chr10 | 122659540 | 743 | HLA-B15:13 | HVIAIEEPVW | 0.9765 | 0.8958 | 12 | 22 |
AGAP1-WDR11 | chr2 | 236403493 | chr10 | 122659540 | 743 | HLA-A25:01 | HVIAIEEPVW | 0.8589 | 0.9055 | 12 | 22 |
AGAP1-WDR11 | chr2 | 236403493 | chr10 | 122659540 | 743 | HLA-A68:02 | EHVIAIEEPV | 0.8181 | 0.6072 | 11 | 21 |
Top |
Potential FusionNeoAntigen Information of AGAP1-WDR11 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of AGAP1-WDR11 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
7432 | QNQIREHVIAIEEP | AGAP1 | WDR11 | chr2 | 236403493 | chr10 | 122659540 | 743 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of AGAP1-WDR11 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 7432 | QNQIREHVIAIEEP | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 7432 | QNQIREHVIAIEEP | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 7432 | QNQIREHVIAIEEP | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 7432 | QNQIREHVIAIEEP | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 7432 | QNQIREHVIAIEEP | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 7432 | QNQIREHVIAIEEP | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 7432 | QNQIREHVIAIEEP | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 7432 | QNQIREHVIAIEEP | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 7432 | QNQIREHVIAIEEP | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 7432 | QNQIREHVIAIEEP | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 7432 | QNQIREHVIAIEEP | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of AGAP1-WDR11 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
AGAP1-WDR11 | chr2 | 236403493 | chr10 | 122659540 | 11 | 20 | EHVIAIEEP | TCGAAGAGCCTGTGTGGTGCCCCTATC |
AGAP1-WDR11 | chr2 | 236403493 | chr10 | 122659540 | 11 | 21 | EHVIAIEEPV | TCGAAGAGCCTGTGTGGTGCCCCTATCTCC |
AGAP1-WDR11 | chr2 | 236403493 | chr10 | 122659540 | 12 | 21 | HVIAIEEPV | AAGAGCCTGTGTGGTGCCCCTATCTCC |
AGAP1-WDR11 | chr2 | 236403493 | chr10 | 122659540 | 12 | 22 | HVIAIEEPVW | AAGAGCCTGTGTGGTGCCCCTATCTCCTTG |
AGAP1-WDR11 | chr2 | 236403493 | chr10 | 122659540 | 7 | 16 | NQIREHVIA | ACGTCATCGCCATCGAAGAGCCTGTGT |
AGAP1-WDR11 | chr2 | 236403493 | chr10 | 122659540 | 8 | 17 | QIREHVIAI | TCATCGCCATCGAAGAGCCTGTGTGGT |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of AGAP1-WDR11 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
BRCA | AGAP1-WDR11 | chr2 | 236403493 | ENST00000304032 | chr10 | 122659540 | ENST00000263461 | TCGA-A8-A08O |
Top |
Potential target of CAR-T therapy development for AGAP1-WDR11 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to AGAP1-WDR11 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to AGAP1-WDR11 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |