Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:F11R-NR1I3

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: F11R-NR1I3
	FusionPDB ID: 28151
	FusionGDB2.0 ID: 28151
		Hgene	Tgene
	Gene symbol	F11R	NR1I3
	Gene ID	50848	9970
	Gene name	F11 receptor	nuclear receptor subfamily 1 group I member 3
	Synonyms	CD321\|JAM\|JAM1\|JAMA\|JCAM\|KAT\|PAM-1	CAR\|CAR1\|MB67
	Cytomap	1q23.3	1q23.3
	Type of gene	protein-coding	protein-coding
	Description	junctional adhesion molecule Ajunctional adhesion molecule 1platelet F11 receptorplatelet adhesion molecule 1	nuclear receptor subfamily 1 group I member 3constitutive activator of retinoid responseconstitutive active receptorconstitutive active responseconstitutive androstane nuclear receptor variant 2constitutive androstane nuclear receptor variant 3const
	Modification date	20200313	20200313
	UniProtAcc	Q9Y624 Main function of 5'-partner protein: FUNCTION: Seems to play a role in epithelial tight junction formation. Appears early in primordial forms of cell junctions and recruits PARD3 (PubMed:11489913). The association of the PARD6-PARD3 complex may prevent the interaction of PARD3 with JAM1, thereby preventing tight junction assembly (By similarity). Plays a role in regulating monocyte transmigration involved in integrity of epithelial barrier (By similarity). Ligand for integrin alpha-L/beta-2 involved in memory T-cell and neutrophil transmigration (PubMed:11812992). Involved in platelet activation (PubMed:10753840). {ECO:0000250\|UniProtKB:O88792, ECO:0000269\|PubMed:10753840, ECO:0000269\|PubMed:11489913, ECO:0000269\|PubMed:11812992}.; FUNCTION: (Microbial infection) Acts as a receptor for Mammalian reovirus sigma-1. {ECO:0000269\|PubMed:11239401}.; FUNCTION: (Microbial infection) Acts as a receptor for Human Rotavirus strain Wa. {ECO:0000269\|PubMed:25481868}.	Q14994 Main function of 5'-partner protein: FUNCTION: Binds and transactivates the retinoic acid response elements that control expression of the retinoic acid receptor beta 2 and alcohol dehydrogenase 3 genes. Transactivates both the phenobarbital responsive element module of the human CYP2B6 gene and the CYP3A4 xenobiotic response element.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000289779, ENST00000368026, ENST00000537746, ENST00000472573,	ENST00000367980, ENST00000367983, ENST00000437437, ENST00000512372, ENST00000506209, ENST00000515452, ENST00000367979, ENST00000367981, ENST00000367982, ENST00000367984, ENST00000367985, ENST00000412844, ENST00000428574, ENST00000442691, ENST00000479324, ENST00000502985, ENST00000504010, ENST00000505005, ENST00000508387, ENST00000508740, ENST00000511676, ENST00000511748, ENST00000511944, ENST00000515621,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	15 X 9 X 8=1080	4 X 4 X 5=80
	# samples	18	5
	** MAII score	log2(18/1080*10)=-2.58496250072116 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(5/80*10)=-0.678071905112638 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: F11R [Title/Abstract] AND NR1I3 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: F11R [Title/Abstract] AND NR1I3 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	F11R(160990800)-NR1I3(161207973), # samples:2
Anticipated loss of major functional domain due to fusion event.	F11R-NR1I3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. F11R-NR1I3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. F11R-NR1I3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. F11R-NR1I3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	F11R	GO:0008360	regulation of cell shape	15344881
Hgene	F11R	GO:0032956	regulation of actin cytoskeleton organization	15344881
Hgene	F11R	GO:0035025	positive regulation of Rho protein signal transduction	26985018
Hgene	F11R	GO:0035683	memory T cell extravasation	11812992
Hgene	F11R	GO:0071260	cellular response to mechanical stimulus	26985018
Hgene	F11R	GO:0098609	cell-cell adhesion	14749337
Hgene	F11R	GO:1901731	positive regulation of platelet aggregation	15344881
Tgene	NR1I3	GO:0045944	positive regulation of transcription by RNA polymerase II	11114890

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:160990800/chr1:161207973)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across F11R (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across NR1I3 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000368026	F11R	chr1	160990800	-	ENST00000512372	NR1I3	chr1	161202736	-	838	339	187	684	165
ENST00000368026	F11R	chr1	160990800	-	ENST00000367980	NR1I3	chr1	161202736	-	1136	339	351	1004	217
ENST00000368026	F11R	chr1	160990800	-	ENST00000367983	NR1I3	chr1	161202736	-	1109	339	351	977	208
ENST00000368026	F11R	chr1	160990800	-	ENST00000437437	NR1I3	chr1	161202736	-	950	339	351	938	195
ENST00000537746	F11R	chr1	160990800	-	ENST00000512372	NR1I3	chr1	161202736	-	586	87	99	569	156
ENST00000537746	F11R	chr1	160990800	-	ENST00000367980	NR1I3	chr1	161202736	-	884	87	99	752	217
ENST00000537746	F11R	chr1	160990800	-	ENST00000367983	NR1I3	chr1	161202736	-	857	87	99	725	208
ENST00000537746	F11R	chr1	160990800	-	ENST00000437437	NR1I3	chr1	161202736	-	698	87	99	686	195

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000368026	ENST00000512372	F11R	chr1	160990800	-	NR1I3	chr1	161202736	-	0.33975372	0.66024625
ENST00000368026	ENST00000367980	F11R	chr1	160990800	-	NR1I3	chr1	161202736	-	0.010189049	0.98981094
ENST00000368026	ENST00000367983	F11R	chr1	160990800	-	NR1I3	chr1	161202736	-	0.010518589	0.98948145
ENST00000368026	ENST00000437437	F11R	chr1	160990800	-	NR1I3	chr1	161202736	-	0.081747584	0.91825247
ENST00000537746	ENST00000512372	F11R	chr1	160990800	-	NR1I3	chr1	161202736	-	0.3119107	0.6880894
ENST00000537746	ENST00000367980	F11R	chr1	160990800	-	NR1I3	chr1	161202736	-	0.008845081	0.9911549
ENST00000537746	ENST00000367983	F11R	chr1	160990800	-	NR1I3	chr1	161202736	-	0.008595922	0.99140406
ENST00000537746	ENST00000437437	F11R	chr1	160990800	-	NR1I3	chr1	161202736	-	0.086918704	0.9130812

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for F11R-NR1I3

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
F11R	chr1	160990800	NR1I3	chr1	161202736	339	51	ETVVPLHIGDPVVLQLICSSITSPCP

Top

Potential FusionNeoAntigen Information of F11R-NR1I3 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

F11R-NR1I3_160990800_161202736.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B15:10	HIGDPVVL	0.9298	0.7036	6	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:01	HIGDPVVL	0.848	0.9325	6	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B38:01	HIGDPVVL	0.6995	0.9804	6	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B38:02	HIGDPVVL	0.6846	0.9784	6	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:01	LHIGDPVVL	0.9984	0.9347	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:24	LHIGDPVVL	0.9982	0.7549	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:13	LHIGDPVVL	0.9977	0.966	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:06	LHIGDPVVL	0.9977	0.9067	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B38:02	LHIGDPVVL	0.996	0.9831	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B38:01	LHIGDPVVL	0.9951	0.9859	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B15:10	LHIGDPVVL	0.9918	0.6356	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B15:37	LHIGDPVVL	0.9818	0.7235	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B14:02	LHIGDPVVL	0.9229	0.9414	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B14:01	LHIGDPVVL	0.9229	0.9414	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-A02:17	IGDPVVLQL	0.8419	0.6434	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B52:01	IGDPVVLQL	0.8415	0.9289	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B15:18	LHIGDPVVL	0.8283	0.813	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B35:04	IGDPVVLQL	0.7411	0.9044	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B35:02	IGDPVVLQL	0.7411	0.9044	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B13:01	IGDPVVLQL	0.419	0.9658	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B48:01	LHIGDPVVL	0.197	0.6567	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B38:01	PLHIGDPVVL	0.2397	0.9765	4	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:01	LHIGDPVVLQL	0.9997	0.9441	5	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:24	LHIGDPVVLQL	0.9997	0.7809	5	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B38:01	LHIGDPVVLQL	0.9993	0.9854	5	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B38:02	LHIGDPVVLQL	0.9991	0.9843	5	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B15:37	LHIGDPVVLQL	0.9946	0.5323	5	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:24	VPLHIGDPVVL	0.9935	0.6673	3	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B35:03	VPLHIGDPVVL	0.9859	0.8513	3	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B35:04	VPLHIGDPVVL	0.9734	0.9327	3	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B35:02	VPLHIGDPVVL	0.9734	0.9327	3	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:01	VPLHIGDPVVL	0.9647	0.8542	3	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B38:01	VPLHIGDPVVL	0.8551	0.9647	3	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B38:02	VPLHIGDPVVL	0.8478	0.9627	3	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B78:01	DPVVLQLI	0.9986	0.5002	9	17
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B51:07	DPVVLQLI	0.9986	0.6347	9	17
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:05	HIGDPVVL	0.6941	0.9189	6	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C05:09	IGDPVVLQL	1	0.9604	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C04:07	IGDPVVLQL	1	0.8824	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C04:10	IGDPVVLQL	1	0.8562	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C08:15	IGDPVVLQL	0.9999	0.9809	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C01:17	IGDPVVLQL	0.9998	0.9495	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C03:19	IGDPVVLQL	0.9994	0.9872	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C03:07	IGDPVVLQL	0.9994	0.953	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C15:04	IGDPVVLQL	0.9987	0.8805	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:09	LHIGDPVVL	0.9986	0.7971	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C04:06	IGDPVVLQL	0.9981	0.9706	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C15:06	IGDPVVLQL	0.998	0.8877	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:12	LHIGDPVVL	0.9978	0.9391	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C03:08	IGDPVVLQL	0.9976	0.8331	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:05	LHIGDPVVL	0.9968	0.9271	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C08:04	IGDPVVLQL	0.9886	0.9768	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C08:13	IGDPVVLQL	0.9886	0.9768	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C01:30	IGDPVVLQL	0.9801	0.9631	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C04:14	IGDPVVLQL	0.9749	0.869	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C03:14	IGDPVVLQL	0.968	0.9666	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C07:10	IGDPVVLQL	0.9532	0.9559	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C07:80	IGDPVVLQL	0.9427	0.9407	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C07:67	IGDPVVLQL	0.9427	0.9407	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C07:05	IGDPVVLQL	0.942	0.9354	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C07:27	IGDPVVLQL	0.9349	0.9331	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C07:19	IGDPVVLQL	0.9249	0.7308	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C07:29	IGDPVVLQL	0.9206	0.8844	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C07:13	IGDPVVLQL	0.9101	0.8942	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:08	IGDPVVLQL	0.8945	0.858	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C07:95	IGDPVVLQL	0.8853	0.6091	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C08:03	IGDPVVLQL	0.86	0.99	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C07:27	LHIGDPVVL	0.8191	0.9732	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B51:07	IGDPVVLQL	0.8145	0.9192	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C07:13	LHIGDPVVL	0.7978	0.9423	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C07:29	LHIGDPVVL	0.786	0.9677	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C02:06	IGDPVVLQL	0.7671	0.9562	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B35:12	IGDPVVLQL	0.7411	0.9044	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C07:67	LHIGDPVVL	0.7051	0.9644	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C07:80	LHIGDPVVL	0.7051	0.9644	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:08	LHIGDPVVL	0.6838	0.8688	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C07:46	LHIGDPVVL	0.6272	0.9367	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:09	IGDPVVLQL	0.5996	0.8397	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B14:03	LHIGDPVVL	0.2836	0.901	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C12:16	LHIGDPVVL	0.0512	0.9758	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B48:03	LHIGDPVVL	0.0369	0.5152	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C05:09	HIGDPVVLQL	0.9999	0.9785	6	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C08:15	HIGDPVVLQL	0.9993	0.9896	6	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C04:06	HIGDPVVLQL	0.9939	0.9784	6	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-A02:07	HIGDPVVLQL	0.8204	0.5723	6	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:05	PLHIGDPVVL	0.2301	0.8558	4	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:09	LHIGDPVVLQL	0.9995	0.8977	5	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:05	LHIGDPVVLQL	0.9992	0.9334	5	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B07:12	VPLHIGDPVVL	0.9985	0.5762	3	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B42:01	VPLHIGDPVVL	0.9736	0.7492	3	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B35:12	VPLHIGDPVVL	0.9734	0.9327	3	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:09	VPLHIGDPVVL	0.9706	0.7997	3	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:10	VPLHIGDPVVL	0.9587	0.8859	3	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:05	VPLHIGDPVVL	0.8604	0.8361	3	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B15:09	HIGDPVVL	0.765	0.8843	6	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B38:05	HIGDPVVL	0.6995	0.9804	6	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C04:01	IGDPVVLQL	1	0.8824	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C04:03	IGDPVVLQL	1	0.9086	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C05:01	IGDPVVLQL	1	0.9604	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C08:02	IGDPVVLQL	0.9999	0.9809	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C18:01	IGDPVVLQL	0.9999	0.8736	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C01:03	IGDPVVLQL	0.9999	0.9192	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C01:02	IGDPVVLQL	0.9998	0.9476	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C15:09	IGDPVVLQL	0.9987	0.8805	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C03:04	IGDPVVLQL	0.9985	0.9843	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C03:03	IGDPVVLQL	0.9985	0.9843	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:02	LHIGDPVVL	0.9984	0.9628	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:31	LHIGDPVVL	0.9982	0.9358	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C03:17	IGDPVVLQL	0.9979	0.9632	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C03:67	IGDPVVLQL	0.9978	0.9735	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C03:05	IGDPVVLQL	0.9977	0.8931	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C15:05	IGDPVVLQL	0.9972	0.9321	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C04:04	IGDPVVLQL	0.9969	0.964	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C15:02	IGDPVVLQL	0.9968	0.881	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C03:02	IGDPVVLQL	0.9957	0.9604	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C06:06	IGDPVVLQL	0.9951	0.9853	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B38:05	LHIGDPVVL	0.9951	0.9859	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C03:06	IGDPVVLQL	0.9942	0.9866	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B15:09	LHIGDPVVL	0.9861	0.8937	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C16:02	IGDPVVLQL	0.9639	0.9886	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C17:01	IGDPVVLQL	0.9615	0.939	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C07:02	IGDPVVLQL	0.9427	0.9407	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C07:04	IGDPVVLQL	0.9327	0.9329	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C07:17	IGDPVVLQL	0.9202	0.9595	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C07:01	IGDPVVLQL	0.919	0.5838	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C07:22	IGDPVVLQL	0.8712	0.6663	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B35:13	IGDPVVLQL	0.8631	0.7326	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C08:01	IGDPVVLQL	0.86	0.99	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B57:02	IGDPVVLQL	0.8191	0.7985	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C03:67	LHIGDPVVL	0.8169	0.9892	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C12:02	IGDPVVLQL	0.7781	0.9746	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C07:17	LHIGDPVVL	0.772	0.9717	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B35:09	IGDPVVLQL	0.7411	0.9044	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C02:10	IGDPVVLQL	0.7131	0.9554	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C02:02	IGDPVVLQL	0.7131	0.9554	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C07:02	LHIGDPVVL	0.7051	0.9644	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:11	LHIGDPVVL	0.6776	0.8106	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:02	IGDPVVLQL	0.5293	0.9504	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C07:04	LHIGDPVVL	0.4757	0.979	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B07:13	IGDPVVLQL	0.1593	0.7683	7	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B40:12	LHIGDPVVL	0.0369	0.5152	5	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C04:03	HIGDPVVLQL	0.9999	0.9634	6	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C05:01	HIGDPVVLQL	0.9999	0.9785	6	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C08:02	HIGDPVVLQL	0.9993	0.9896	6	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-C17:01	HIGDPVVLQL	0.9393	0.9716	6	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-A02:14	HIGDPVVLQL	0.853	0.6251	6	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B38:05	PLHIGDPVVL	0.2397	0.9765	4	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:31	LHIGDPVVLQL	0.9997	0.9455	5	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B38:05	LHIGDPVVLQL	0.9993	0.9854	5	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B15:09	LHIGDPVVLQL	0.9965	0.802	5	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B55:04	VPLHIGDPVVL	0.9894	0.5184	3	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B35:13	VPLHIGDPVVL	0.9839	0.8555	3	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:11	LHIGDPVVLQL	0.9821	0.8131	5	16
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B35:09	VPLHIGDPVVL	0.9734	0.9327	3	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B67:01	VPLHIGDPVVL	0.9547	0.8087	3	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B39:11	VPLHIGDPVVL	0.8927	0.8751	3	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B38:05	VPLHIGDPVVL	0.8551	0.9647	3	14
F11R-NR1I3	chr1	160990800	chr1	161202736	339	HLA-B15:09	VPLHIGDPVVL	0.8235	0.7085	3	14

Top

Potential FusionNeoAntigen Information of F11R-NR1I3 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of F11R-NR1I3

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
3362	HIGDPVVLQLICSS	F11R	NR1I3	chr1	160990800	chr1	161202736	339

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of F11R-NR1I3

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	3362	HIGDPVVLQLICSS	-7.9962	-8.1096
HLA-B14:02	3BVN	3362	HIGDPVVLQLICSS	-5.70842	-6.74372
HLA-B52:01	3W39	3362	HIGDPVVLQLICSS	-6.83737	-6.95077
HLA-B52:01	3W39	3362	HIGDPVVLQLICSS	-4.4836	-5.5189
HLA-A11:01	4UQ2	3362	HIGDPVVLQLICSS	-10.0067	-10.1201
HLA-A11:01	4UQ2	3362	HIGDPVVLQLICSS	-9.03915	-10.0745
HLA-A24:02	5HGA	3362	HIGDPVVLQLICSS	-6.56204	-6.67544
HLA-A24:02	5HGA	3362	HIGDPVVLQLICSS	-5.42271	-6.45801
HLA-B44:05	3DX8	3362	HIGDPVVLQLICSS	-7.85648	-8.89178
HLA-B44:05	3DX8	3362	HIGDPVVLQLICSS	-5.3978	-5.5112
HLA-A02:01	6TDR	3362	HIGDPVVLQLICSS	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of F11R-NR1I3

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
F11R-NR1I3	chr1	160990800	chr1	161202736	3	14	VPLHIGDPVVL	TGTGCCTCTTCATATTGGCGATCCTGTTGTCCT
F11R-NR1I3	chr1	160990800	chr1	161202736	4	14	PLHIGDPVVL	GCCTCTTCATATTGGCGATCCTGTTGTCCT
F11R-NR1I3	chr1	160990800	chr1	161202736	5	14	LHIGDPVVL	TCTTCATATTGGCGATCCTGTTGTCCT
F11R-NR1I3	chr1	160990800	chr1	161202736	5	16	LHIGDPVVLQL	TCTTCATATTGGCGATCCTGTTGTCCTCCAGCT
F11R-NR1I3	chr1	160990800	chr1	161202736	6	14	HIGDPVVL	TCATATTGGCGATCCTGTTGTCCT
F11R-NR1I3	chr1	160990800	chr1	161202736	6	16	HIGDPVVLQL	TCATATTGGCGATCCTGTTGTCCTCCAGCT
F11R-NR1I3	chr1	160990800	chr1	161202736	7	16	IGDPVVLQL	TATTGGCGATCCTGTTGTCCTCCAGCT
F11R-NR1I3	chr1	160990800	chr1	161202736	9	17	DPVVLQLI	CGATCCTGTTGTCCTCCAGCTCAT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of F11R-NR1I3

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LUSC	F11R-NR1I3	chr1	160990800	ENST00000368026	chr1	161202736	ENST00000512372	TCGA-22-4607-01A

Top

Potential target of CAR-T therapy development for F11R-NR1I3

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to F11R-NR1I3

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to F11R-NR1I3

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)