Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:FABP7-EPRS

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: FABP7-EPRS
	FusionPDB ID: 28210
	FusionGDB2.0 ID: 28210
		Hgene	Tgene
	Gene symbol	FABP7	EPRS
	Gene ID	2173	2058
	Gene name	fatty acid binding protein 7	glutamyl-prolyl-tRNA synthetase 1
	Synonyms	B-FABP\|BLBP\|FABPB\|MRG	EARS\|EPRS\|GLUPRORS\|HLD15\|PARS\|PIG32\|QARS\|QPRS
	Cytomap	6q22.31	1q41
	Type of gene	protein-coding	protein-coding
	Description	fatty acid-binding protein, brainbrain lipid-binding proteinbrain-type fatty acid-binding proteinhypothetical protein DKFZp547J2313mammary-derived growth inhibitor-related	bifunctional glutamate/proline--tRNA ligasebifunctional aminoacyl-tRNA synthetasecell proliferation-inducing gene 32 proteinglutamate tRNA ligaseglutamatyl-prolyl-tRNA synthetaseglutaminyl-tRNA synthetaseproliferation-inducing gene 32 proteinprolif
	Modification date	20200313	20200313
	UniProtAcc	O15540 Main function of 5'-partner protein: FUNCTION: B-FABP could be involved in the transport of a so far unknown hydrophobic ligand with potential morphogenic activity during CNS development. It is required for the establishment of the radial glial fiber system in developing brain, a system that is necessary for the migration of immature neurons to establish cortical layers (By similarity). {ECO:0000250}.	P07814 Main function of 5'-partner protein: FUNCTION: Multifunctional protein which is primarily part of the aminoacyl-tRNA synthetase multienzyme complex, also know as multisynthetase complex, that catalyzes the attachment of the cognate amino acid to the corresponding tRNA in a two-step reaction: the amino acid is first activated by ATP to form a covalent intermediate with AMP and is then transferred to the acceptor end of the cognate tRNA (PubMed:1756734, PubMed:24100331, PubMed:23263184). The phosphorylation of EPRS1, induced by interferon-gamma, dissociates the protein from the aminoacyl-tRNA synthetase multienzyme complex and recruits it to the GAIT complex that binds to stem loop-containing GAIT elements in the 3'-UTR of diverse inflammatory mRNAs (such as ceruplasmin), suppressing their translation. Interferon-gamma can therefore redirect, in specific cells, the EPRS1 function from protein synthesis to translation inhibition (PubMed:15479637, PubMed:23071094). Also functions as an effector of the mTORC1 signaling pathway by promoting, through SLC27A1, the uptake of long-chain fatty acid by adipocytes. Thereby, it also plays a role in fat metabolism and more indirectly influences lifespan (PubMed:28178239). {ECO:0000269\|PubMed:15479637, ECO:0000269\|PubMed:1756734, ECO:0000269\|PubMed:23071094, ECO:0000269\|PubMed:23263184, ECO:0000269\|PubMed:24100331, ECO:0000269\|PubMed:28178239}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000356535, ENST00000368444,	ENST00000468487, ENST00000366923,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	2 X 2 X 2=8	9 X 9 X 4=324
	# samples	2	9
	** MAII score	log2(2/8*10)=1.32192809488736	log2(9/324*10)=-1.84799690655495 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: FABP7 [Title/Abstract] AND EPRS [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: FABP7 [Title/Abstract] AND EPRS [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	FABP7(123102339)-EPRS(220146740), # samples:1
Anticipated loss of major functional domain due to fusion event.	FABP7-EPRS seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FABP7-EPRS seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. FABP7-EPRS seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. FABP7-EPRS seems lost the major protein functional domain in Tgene partner, which is a cell metabolism gene due to the frame-shifted ORF. FABP7-EPRS seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	EPRS	GO:0006433	prolyl-tRNA aminoacylation	24100331
Tgene	EPRS	GO:0017148	negative regulation of translation	23071094
Tgene	EPRS	GO:0071346	cellular response to interferon-gamma	15479637

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr6:123102339/chr1:220146740)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across FABP7 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across EPRS (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst

Tenst

Hgene

Hchr

Hbp

Hstrand

Tgene

Tchr

Tbp

Tstrand

Seq length
(transcript)

BP loci
(transcript)

Predicted start
(transcript)

Predicted stop
(transcript)

Seq length
(amino acids)

ENST00000368444

FABP7

chr6

123102339

ENST00000366923

EPRS

chr1

220146740

1329

668

320

1123

267

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000368444	ENST00000366923	FABP7	chr6	123102339	+	EPRS	chr1	220146740	-	0.002091202	0.99790883

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for FABP7-EPRS

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
FABP7	chr6	123102339	EPRS	chr1	220146740	668	116	NFVREIKDGKMVMGVPIRLEVGPRDM

Top

Potential FusionNeoAntigen Information of FABP7-EPRS in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

FABP7-EPRS_123102339_220146740.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-B15:17	MVMGVPIRL	0.9904	0.8783	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A02:21	MVMGVPIRL	0.9887	0.5729	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A02:04	MVMGVPIRL	0.9874	0.5395	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-B35:03	MVMGVPIRL	0.9869	0.922	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A02:11	MVMGVPIRL	0.9861	0.5108	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A02:22	MVMGVPIRL	0.9859	0.5269	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-B15:16	MVMGVPIRL	0.9806	0.7705	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-B52:01	MGVPIRLEV	0.9791	0.9553	12	21
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A02:38	MVMGVPIRL	0.9789	0.8099	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A02:13	MVMGVPIRL	0.9581	0.6916	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A74:09	KMVMGVPIR	0.9562	0.6655	9	18
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A74:03	KMVMGVPIR	0.9562	0.6655	9	18
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A74:11	KMVMGVPIR	0.9562	0.6655	9	18
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A02:27	MVMGVPIRL	0.9555	0.5607	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A32:13	MVMGVPIRL	0.954	0.8629	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A31:02	KMVMGVPIR	0.9425	0.6278	9	18
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-B35:02	MVMGVPIRL	0.8696	0.9554	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-B35:04	MVMGVPIRL	0.8696	0.9554	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-B13:01	MVMGVPIRL	0.5669	0.8979	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A02:04	KMVMGVPIRL	0.9775	0.5285	9	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A32:13	KMVMGVPIRL	0.9269	0.9313	9	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C15:06	MVMGVPIRL	0.9997	0.893	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C15:04	MVMGVPIRL	0.9997	0.8474	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C03:07	MVMGVPIRL	0.9994	0.9756	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C03:08	MVMGVPIRL	0.999	0.8924	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C03:19	MVMGVPIRL	0.9988	0.9861	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C04:06	MVMGVPIRL	0.9984	0.7765	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C04:14	MVMGVPIRL	0.9949	0.8049	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C03:19	MGVPIRLEV	0.994	0.9894	12	21
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-B78:01	MGVPIRLEV	0.993	0.624	12	21
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C12:04	MGVPIRLEV	0.9911	0.9915	12	21
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C08:13	MVMGVPIRL	0.9907	0.9373	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C08:04	MVMGVPIRL	0.9907	0.9373	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C07:13	MVMGVPIRL	0.9899	0.8801	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C06:03	MGVPIRLEV	0.9899	0.9933	12	21
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A02:05	MVMGVPIRL	0.9897	0.5072	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A02:07	MVMGVPIRL	0.9882	0.513	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C07:29	MVMGVPIRL	0.9875	0.9179	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-B51:07	MGVPIRLEV	0.9871	0.9305	12	21
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C07:05	MVMGVPIRL	0.9805	0.9577	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C06:03	MVMGVPIRL	0.9805	0.9929	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C12:12	MVMGVPIRL	0.98	0.9309	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C12:04	MVMGVPIRL	0.9775	0.9921	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C08:03	MVMGVPIRL	0.9768	0.9737	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C02:06	MGVPIRLEV	0.9747	0.9676	12	21
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C03:14	MVMGVPIRL	0.9713	0.9788	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C02:06	MVMGVPIRL	0.969	0.8806	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C12:12	MGVPIRLEV	0.9662	0.9636	12	21
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A31:01	KMVMGVPIR	0.9627	0.6057	9	18
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C07:95	MVMGVPIRL	0.9538	0.5823	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C07:27	MVMGVPIRL	0.9417	0.9448	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-B35:12	MVMGVPIRL	0.8696	0.9554	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-B39:10	MVMGVPIRL	0.693	0.8813	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C15:09	MVMGVPIRL	0.9997	0.8474	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C15:05	MVMGVPIRL	0.9996	0.8682	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C15:05	MGVPIRLEV	0.9995	0.9313	12	21
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C15:02	MVMGVPIRL	0.9995	0.8183	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C15:02	MGVPIRLEV	0.9995	0.8957	12	21
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C03:03	MVMGVPIRL	0.9988	0.9901	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C03:04	MVMGVPIRL	0.9988	0.9901	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C03:67	MVMGVPIRL	0.9981	0.9798	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C16:04	MVMGVPIRL	0.9978	0.9844	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C03:17	MVMGVPIRL	0.9978	0.9679	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C03:02	MVMGVPIRL	0.9972	0.9749	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C04:04	MVMGVPIRL	0.9972	0.7515	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C03:05	MVMGVPIRL	0.9969	0.8434	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C16:02	MVMGVPIRL	0.9961	0.994	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A68:02	MVMGVPIRL	0.9942	0.6208	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A69:01	MVMGVPIRL	0.9908	0.7027	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C03:06	MVMGVPIRL	0.9906	0.9919	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C12:03	MVMGVPIRL	0.9901	0.9797	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A02:14	MVMGVPIRL	0.9892	0.5314	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A02:06	MVMGVPIRL	0.9887	0.5729	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-B35:13	MVMGVPIRL	0.9859	0.9228	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A32:01	MVMGVPIRL	0.9829	0.8907	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C07:22	MVMGVPIRL	0.98	0.7186	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A02:03	MVMGVPIRL	0.9797	0.6186	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C08:01	MVMGVPIRL	0.9768	0.9737	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A25:01	MVMGVPIRL	0.9767	0.9044	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C16:04	MGVPIRLEV	0.9764	0.9814	12	21
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C06:02	MVMGVPIRL	0.9744	0.9915	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C06:17	MVMGVPIRL	0.9744	0.9915	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C07:04	MVMGVPIRL	0.9702	0.9305	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C12:03	MGVPIRLEV	0.9674	0.9822	12	21
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C06:06	MVMGVPIRL	0.9648	0.9929	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A74:01	KMVMGVPIR	0.9562	0.6655	9	18
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C06:08	MVMGVPIRL	0.9499	0.9736	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C02:10	MVMGVPIRL	0.9484	0.9457	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C02:02	MVMGVPIRL	0.9484	0.9457	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C07:01	MVMGVPIRL	0.9322	0.5762	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C12:02	MVMGVPIRL	0.9198	0.9726	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-B15:73	MVMGVPIRL	0.8837	0.7371	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-B35:09	MVMGVPIRL	0.8696	0.9554	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-B07:13	MVMGVPIRL	0.8495	0.7182	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-B15:30	MVMGVPIRL	0.8351	0.7076	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-C17:01	MVMGVPIRL	0.7382	0.6796	10	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A32:01	KMVMGVPIRL	0.981	0.9146	9	19
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A68:02	MVMGVPIRLEV	0.9982	0.8848	10	21
FABP7-EPRS	chr6	123102339	chr1	220146740	668	HLA-A69:01	MVMGVPIRLEV	0.997	0.7916	10	21

Top

Potential FusionNeoAntigen Information of FABP7-EPRS in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of FABP7-EPRS

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
4145	KDGKMVMGVPIRLE	FABP7	EPRS	chr6	123102339	chr1	220146740	668

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of FABP7-EPRS

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	4145	KDGKMVMGVPIRLE	-7.15543	-7.26883
HLA-B14:02	3BVN	4145	KDGKMVMGVPIRLE	-4.77435	-5.80965
HLA-B52:01	3W39	4145	KDGKMVMGVPIRLE	-6.80875	-6.92215
HLA-B52:01	3W39	4145	KDGKMVMGVPIRLE	-4.20386	-5.23916
HLA-A11:01	4UQ2	4145	KDGKMVMGVPIRLE	-7.5194	-8.5547
HLA-A11:01	4UQ2	4145	KDGKMVMGVPIRLE	-6.9601	-7.0735
HLA-A24:02	5HGA	4145	KDGKMVMGVPIRLE	-7.52403	-7.63743
HLA-A24:02	5HGA	4145	KDGKMVMGVPIRLE	-5.82433	-6.85963
HLA-B27:05	6PYJ	4145	KDGKMVMGVPIRLE	-3.28285	-4.31815
HLA-B44:05	3DX8	4145	KDGKMVMGVPIRLE	-5.91172	-6.94702
HLA-B44:05	3DX8	4145	KDGKMVMGVPIRLE	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of FABP7-EPRS

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
FABP7-EPRS	chr6	123102339	chr1	220146740	10	19	MVMGVPIRL	ATGGTTATGGGAGTTCCCATTAGACTT
FABP7-EPRS	chr6	123102339	chr1	220146740	10	21	MVMGVPIRLEV	ATGGTTATGGGAGTTCCCATTAGACTTGAAGTT
FABP7-EPRS	chr6	123102339	chr1	220146740	12	21	MGVPIRLEV	ATGGGAGTTCCCATTAGACTTGAAGTT
FABP7-EPRS	chr6	123102339	chr1	220146740	9	18	KMVMGVPIR	AAAATGGTTATGGGAGTTCCCATTAGA
FABP7-EPRS	chr6	123102339	chr1	220146740	9	19	KMVMGVPIRL	AAAATGGTTATGGGAGTTCCCATTAGACTT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of FABP7-EPRS

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
GBM	FABP7-EPRS	chr6	123102339	ENST00000368444	chr1	220146740	ENST00000366923	TCGA-06-2563

Top

Potential target of CAR-T therapy development for FABP7-EPRS

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to FABP7-EPRS

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to FABP7-EPRS

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)