Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:FAF1-EPS15

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: FAF1-EPS15
	FusionPDB ID: 28233
	FusionGDB2.0 ID: 28233
		Hgene	Tgene
	Gene symbol	FAF1	EPS15
	Gene ID	11124	2060
	Gene name	Fas associated factor 1	epidermal growth factor receptor pathway substrate 15
	Synonyms	CGI-03\|HFAF1s\|UBXD12\|UBXN3A\|hFAF1	AF-1P\|AF1P\|MLLT5
	Cytomap	1p32.3	1p32.3
	Type of gene	protein-coding	protein-coding
	Description	FAS-associated factor 1Fas (TNFRSF6) associated factor 1TNFRSF6-associated factor 1UBX domain protein 3AUBX domain-containing protein 12UBX domain-containing protein 3A	epidermal growth factor receptor substrate 15ALL1 fused gene from chromosome 1protein AF-1p
	Modification date	20200313	20200313
	UniProtAcc	Q9UNN5 Main function of 5'-partner protein: FUNCTION: Ubiquitin-binding protein (PubMed:19722279). Required for the progression of DNA replication forks by targeting DNA replication licensing factor CDT1 for degradation (PubMed:26842564). Potentiates but cannot initiate FAS-induced apoptosis (By similarity). {ECO:0000250\|UniProtKB:P54731, ECO:0000269\|PubMed:19722279, ECO:0000269\|PubMed:26842564}.	Q9UBC2 Main function of 5'-partner protein: FUNCTION: Seems to be a constitutive component of clathrin-coated pits that is required for receptor-mediated endocytosis. Involved in endocytosis of integrin beta-1 (ITGB1) and transferrin receptor (TFR); internalization of ITGB1 as DAB2-dependent cargo but not TFR seems to require association with DAB2. {ECO:0000269\|PubMed:22648170, ECO:0000269\|PubMed:9407958}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000371778, ENST00000396153, ENST00000472808, ENST00000545823,	ENST00000396122, ENST00000493793, ENST00000371730, ENST00000371733,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	23 X 21 X 9=4347	11 X 14 X 5=770
	# samples	31	14
	** MAII score	log2(31/4347*10)=-3.80967997500385 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(14/770*10)=-2.4594316186373 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: FAF1 [Title/Abstract] AND EPS15 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: FAF1 [Title/Abstract] AND EPS15 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	FAF1(51323601)-EPS15(51946986), # samples:2 EPS15(51984870)-FAF1(51323669), # samples:1
Anticipated loss of major functional domain due to fusion event.	EPS15-FAF1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EPS15-FAF1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. FAF1-EPS15 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FAF1-EPS15 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FAF1-EPS15 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. FAF1-EPS15 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. FAF1-EPS15 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. FAF1-EPS15 seems lost the major protein functional domain in Tgene partner, which is a CGC due to the frame-shifted ORF. FAF1-EPS15 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	FAF1	GO:0010942	positive regulation of cell death	15596450
Tgene	EPS15	GO:0048268	clathrin coat assembly	12807910

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:51323601/chr1:51946986)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across FAF1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across EPS15 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000396153	FAF1	chr1	51323600	-	ENST00000371730	EPS15	chr1	51946986	-	5259	566	140	2821	893
ENST00000396153	FAF1	chr1	51323600	-	ENST00000371733	EPS15	chr1	51946986	-	5661	566	140	3223	1027
ENST00000396153	FAF1	chr1	51323601	-	ENST00000371730	EPS15	chr1	51946986	-	5259	566	140	2821	893
ENST00000396153	FAF1	chr1	51323601	-	ENST00000371733	EPS15	chr1	51946986	-	5661	566	140	3223	1027
ENST00000396153	FAF1	chr1	51171458	-	ENST00000371730	EPS15	chr1	51946986	-	5802	1109	140	3364	1074
ENST00000396153	FAF1	chr1	51171458	-	ENST00000371733	EPS15	chr1	51946986	-	6204	1109	140	3766	1208

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000396153	ENST00000371730	FAF1	chr1	51323600	-	EPS15	chr1	51946986	-	0.000119288	0.9998807
ENST00000396153	ENST00000371733	FAF1	chr1	51323600	-	EPS15	chr1	51946986	-	0.000113474	0.9998865
ENST00000396153	ENST00000371730	FAF1	chr1	51323601	-	EPS15	chr1	51946986	-	0.000119288	0.9998807
ENST00000396153	ENST00000371733	FAF1	chr1	51323601	-	EPS15	chr1	51946986	-	0.000113474	0.9998865
ENST00000396153	ENST00000371730	FAF1	chr1	51171458	-	EPS15	chr1	51946986	-	7.60E-05	0.99992394
ENST00000396153	ENST00000371733	FAF1	chr1	51171458	-	EPS15	chr1	51946986	-	0.000202652	0.9997974

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for FAF1-EPS15

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
FAF1	chr1	51171458	EPS15	chr1	51946986	1109	323	YNLNFSGSSTIQELSSGNPVYEKYYR
FAF1	chr1	51323600	EPS15	chr1	51946986	566	142	AITLLEQNNWDLVLSSGNPVYEKYYR
FAF1	chr1	51323601	EPS15	chr1	51946986	566	142	AITLLEQNNWDLVLSSGNPVYEKYYR

Top

Potential FusionNeoAntigen Information of FAF1-EPS15 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

FAF1-EPS15_51171458_51946986.msa
FAF1-EPS15_51323600_51946986.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B45:01	QELSSGNPV	0.9959	0.7961	11	20
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B50:02	QELSSGNPV	0.9948	0.6744	11	20
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:01	ELSSGNPVY	0.965	0.8084	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:25	ELSSGNPVY	0.889	0.8508	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:02	ELSSGNPVY	0.8857	0.8601	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B41:01	QELSSGNPV	0.7769	0.9313	11	20
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B35:08	ELSSGNPVY	0.7573	0.7104	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B50:01	QELSSGNPV	0.5691	0.8209	11	20
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B35:01	ELSSGNPVY	0.5091	0.7232	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B44:03	QELSSGNPVY	0.9931	0.8421	11	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B18:01	QELSSGNPVY	0.895	0.75	11	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:25	QELSSGNPVY	0.8723	0.8083	11	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:02	QELSSGNPVY	0.8089	0.8368	11	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:01	IQELSSGNPVY	0.9995	0.6646	10	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:25	IQELSSGNPVY	0.9835	0.7545	10	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:03	IQELSSGNPVY	0.8707	0.5172	10	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-C03:19	SGSSTIQEL	0.9983	0.9826	5	14
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B40:06	QELSSGNPV	0.996	0.7278	11	20
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-C01:17	SGSSTIQEL	0.9857	0.9325	5	14
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-C08:13	SGSSTIQEL	0.9554	0.9487	5	14
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-C08:04	SGSSTIQEL	0.9554	0.9487	5	14
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-C01:30	SGSSTIQEL	0.8951	0.9345	5	14
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:21	ELSSGNPVY	0.8876	0.8467	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-C08:03	SGSSTIQEL	0.7389	0.9786	5	14
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-C02:06	SGSSTIQEL	0.6714	0.9605	5	14
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:05	ELSSGNPVY	0.6439	0.6837	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:31	ELSSGNPVY	0.605	0.6935	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:05	QELSSGNPVY	0.8825	0.7616	11	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:31	QELSSGNPVY	0.8499	0.7762	11	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:05	IQELSSGNPVY	0.9862	0.6779	10	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-C03:04	SGSSTIQEL	0.9978	0.9885	5	14
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-C03:03	SGSSTIQEL	0.9978	0.9885	5	14
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-C15:05	SGSSTIQEL	0.9976	0.8579	5	14
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-C03:05	SGSSTIQEL	0.997	0.9203	5	14
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-C15:02	SGSSTIQEL	0.997	0.8307	5	14
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-C03:17	SGSSTIQEL	0.9962	0.9746	5	14
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-C01:03	SGSSTIQEL	0.9932	0.8922	5	14
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-C01:02	SGSSTIQEL	0.9887	0.9291	5	14
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B40:04	QELSSGNPV	0.9698	0.668	11	20
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:33	ELSSGNPVY	0.965	0.8084	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:125	ELSSGNPVY	0.965	0.8084	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:34	ELSSGNPVY	0.965	0.8084	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:27	ELSSGNPVY	0.9621	0.8377	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:135	ELSSGNPVY	0.9586	0.8323	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:11	ELSSGNPVY	0.9327	0.7371	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-A25:01	ELSSGNPVY	0.9273	0.7299	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:50	ELSSGNPVY	0.927	0.8905	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:08	ELSSGNPVY	0.9269	0.7509	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B35:13	SGSSTIQEL	0.9013	0.8652	5	14
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:12	ELSSGNPVY	0.8939	0.8479	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B35:43	ELSSGNPVY	0.8916	0.7467	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:39	ELSSGNPVY	0.879	0.719	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B41:03	QELSSGNPV	0.8511	0.7031	11	20
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B35:11	ELSSGNPVY	0.8312	0.8243	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-C07:04	SGSSTIQEL	0.7679	0.911	5	14
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-C16:01	SGSSTIQEL	0.7611	0.9717	5	14
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-C08:01	SGSSTIQEL	0.7389	0.9786	5	14
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-C17:01	SGSSTIQEL	0.7032	0.9323	5	14
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:20	ELSSGNPVY	0.6569	0.7432	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B50:05	QELSSGNPV	0.5691	0.8209	11	20
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B50:04	QELSSGNPV	0.5691	0.8209	11	20
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B35:20	ELSSGNPVY	0.538	0.7568	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B35:28	ELSSGNPVY	0.5237	0.7404	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B35:77	ELSSGNPVY	0.5091	0.7232	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B35:23	ELSSGNPVY	0.5014	0.6518	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B35:24	ELSSGNPVY	0.305	0.7606	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B07:13	SGSSTIQEL	0.2611	0.7804	5	14
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B18:04	ELSSGNPVY	0.206	0.838	12	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B44:26	QELSSGNPVY	0.9931	0.8421	11	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B44:07	QELSSGNPVY	0.9931	0.8421	11	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B44:13	QELSSGNPVY	0.9931	0.8421	11	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:12	QELSSGNPVY	0.9415	0.6836	11	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B18:04	QELSSGNPVY	0.9352	0.7691	11	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B18:11	QELSSGNPVY	0.8999	0.7981	11	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:53	QELSSGNPVY	0.8968	0.6392	11	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B18:05	QELSSGNPVY	0.895	0.75	11	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B18:08	QELSSGNPVY	0.8913	0.6829	11	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:20	QELSSGNPVY	0.8811	0.8091	11	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B18:06	QELSSGNPVY	0.8578	0.7424	11	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B35:28	QELSSGNPVY	0.8461	0.8068	11	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B18:03	QELSSGNPVY	0.8347	0.7298	11	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B35:20	QELSSGNPVY	0.8092	0.8193	11	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B48:02	QELSSGNPVY	0.6781	0.794	11	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:125	IQELSSGNPVY	0.9995	0.6646	10	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:33	IQELSSGNPVY	0.9995	0.6646	10	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:34	IQELSSGNPVY	0.9995	0.6646	10	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:135	IQELSSGNPVY	0.9994	0.6878	10	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:27	IQELSSGNPVY	0.9994	0.6855	10	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:50	IQELSSGNPVY	0.9991	0.8229	10	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:12	IQELSSGNPVY	0.9981	0.6399	10	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:35	IQELSSGNPVY	0.9965	0.6576	10	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:53	IQELSSGNPVY	0.9922	0.6157	10	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:20	IQELSSGNPVY	0.9868	0.752	10	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:39	IQELSSGNPVY	0.9825	0.6158	10	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B35:28	IQELSSGNPVY	0.982	0.7486	10	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B15:54	IQELSSGNPVY	0.9734	0.5727	10	21
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	HLA-B48:02	IQELSSGNPVY	0.846	0.729	10	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:01	VLSSGNPVY	0.9981	0.851	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:25	VLSSGNPVY	0.9705	0.8854	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B39:01	EQNNWDLVL	0.9691	0.816	5	14
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B39:13	EQNNWDLVL	0.9543	0.8285	5	14
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:02	VLSSGNPVY	0.9322	0.8955	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B38:02	EQNNWDLVL	0.9141	0.8981	5	14
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B38:01	EQNNWDLVL	0.8881	0.8753	5	14
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B35:08	VLSSGNPVY	0.7924	0.767	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B35:01	VLSSGNPVY	0.603	0.8643	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B13:01	EQNNWDLVL	0.5925	0.7665	5	14
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:03	VLSSGNPVY	0.2374	0.6847	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:01	LVLSSGNPVY	0.9971	0.9134	11	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:25	LVLSSGNPVY	0.9874	0.9032	11	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:02	LVLSSGNPVY	0.9794	0.9117	11	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B39:09	EQNNWDLVL	0.977	0.5743	5	14
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B39:12	EQNNWDLVL	0.9522	0.8171	5	14
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:21	VLSSGNPVY	0.9318	0.8862	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B39:05	EQNNWDLVL	0.9147	0.7793	5	14
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B39:08	EQNNWDLVL	0.9125	0.7285	5	14
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:05	VLSSGNPVY	0.7828	0.8389	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:04	VLSSGNPVY	0.7566	0.8528	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:31	VLSSGNPVY	0.66	0.8468	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-C03:14	VLSSGNPVY	0.0222	0.9743	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:05	LVLSSGNPVY	0.9434	0.884	11	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:31	LVLSSGNPVY	0.911	0.8878	11	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:31	DLVLSSGNPVY	0.8983	0.7673	10	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:27	VLSSGNPVY	0.9982	0.8259	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:34	VLSSGNPVY	0.9981	0.851	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:125	VLSSGNPVY	0.9981	0.851	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:33	VLSSGNPVY	0.9981	0.851	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:135	VLSSGNPVY	0.9977	0.8554	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:50	VLSSGNPVY	0.9974	0.8582	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:11	VLSSGNPVY	0.9954	0.81	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:08	VLSSGNPVY	0.9949	0.8359	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:12	VLSSGNPVY	0.9934	0.8586	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B35:43	VLSSGNPVY	0.9915	0.8287	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:24	VLSSGNPVY	0.9882	0.8321	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:35	VLSSGNPVY	0.9723	0.8328	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B39:02	EQNNWDLVL	0.9722	0.8353	5	14
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:39	VLSSGNPVY	0.9719	0.7749	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B39:31	EQNNWDLVL	0.9715	0.8128	5	14
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:53	VLSSGNPVY	0.9585	0.8086	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B35:11	VLSSGNPVY	0.9033	0.8757	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B38:05	EQNNWDLVL	0.8881	0.8753	5	14
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B39:11	EQNNWDLVL	0.8577	0.683	5	14
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:20	VLSSGNPVY	0.7958	0.8857	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:73	EQNNWDLVL	0.7409	0.6608	5	14
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:30	EQNNWDLVL	0.7067	0.5893	5	14
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B35:28	VLSSGNPVY	0.686	0.8837	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B35:20	VLSSGNPVY	0.6307	0.8883	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B35:23	VLSSGNPVY	0.6209	0.7835	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B35:77	VLSSGNPVY	0.603	0.8643	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:13	VLSSGNPVY	0.57	0.575	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:54	VLSSGNPVY	0.5402	0.7627	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-C03:02	VLSSGNPVY	0.075	0.9504	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B48:02	VLSSGNPVY	0.0555	0.8647	12	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:50	LVLSSGNPVY	0.9973	0.9419	11	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:34	LVLSSGNPVY	0.9971	0.9134	11	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:33	LVLSSGNPVY	0.9971	0.9134	11	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:27	LVLSSGNPVY	0.9971	0.8675	11	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:125	LVLSSGNPVY	0.9971	0.9134	11	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:135	LVLSSGNPVY	0.9955	0.9273	11	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:39	LVLSSGNPVY	0.9869	0.8249	11	21
FAF1-EPS15	chr1	51323600	chr1	51946986	566	HLA-B15:20	LVLSSGNPVY	0.946	0.9181	11	21

Top

Potential FusionNeoAntigen Information of FAF1-EPS15 in HLA II

FAF1-EPS15_51171458_51946986.msa
FAF1-EPS15_51323600_51946986.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	DRB1-0417	NLNFSGSSTIQELSS	1	16
FAF1-EPS15	chr1	51171458	chr1	51946986	1109	DRB1-0417	YNLNFSGSSTIQELS	0	15
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0701	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0701	NNWDLVLSSGNPVYE	7	22
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0703	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0703	NNWDLVLSSGNPVYE	7	22
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0704	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0704	NNWDLVLSSGNPVYE	7	22
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0705	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0705	NNWDLVLSSGNPVYE	7	22
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0706	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0707	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0707	NNWDLVLSSGNPVYE	7	22
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0708	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0708	NNWDLVLSSGNPVYE	7	22
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0709	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0709	NNWDLVLSSGNPVYE	7	22
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0711	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0712	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0712	NNWDLVLSSGNPVYE	7	22
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0713	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0713	NNWDLVLSSGNPVYE	7	22
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0714	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0714	NNWDLVLSSGNPVYE	7	22
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0715	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0715	NNWDLVLSSGNPVYE	7	22
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0716	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0716	NNWDLVLSSGNPVYE	7	22
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0717	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0717	NNWDLVLSSGNPVYE	7	22
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0719	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0719	NNWDLVLSSGNPVYE	7	22
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0901	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0904	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0904	NNWDLVLSSGNPVYE	7	22
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0905	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0906	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0906	NNWDLVLSSGNPVYE	7	22
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0907	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-0909	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-1439	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-1448	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-1450	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-1493	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-1525	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB1-1525	NNWDLVLSSGNPVYE	7	22
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB3-0201	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB3-0209	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB3-0221	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB3-0224	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB3-0301	NWDLVLSSGNPVYEK	8	23
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB3-0301	NNWDLVLSSGNPVYE	7	22
FAF1-EPS15	chr1	51323600	chr1	51946986	566	DRB3-0303	NWDLVLSSGNPVYEK	8	23

Top

Fusion breakpoint peptide structures of FAF1-EPS15

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
3151	GSSTIQELSSGNPV	FAF1	EPS15	chr1	51171458	chr1	51946986	1109

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7430	QNNWDLVLSSGNPV	FAF1	EPS15	chr1	51323600	chr1	51946986	566

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of FAF1-EPS15

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	3151	GSSTIQELSSGNPV	-7.9962	-8.1096
HLA-B14:02	3BVN	3151	GSSTIQELSSGNPV	-5.70842	-6.74372
HLA-B52:01	3W39	3151	GSSTIQELSSGNPV	-6.83737	-6.95077
HLA-B52:01	3W39	3151	GSSTIQELSSGNPV	-4.4836	-5.5189
HLA-A11:01	4UQ2	3151	GSSTIQELSSGNPV	-10.0067	-10.1201
HLA-A11:01	4UQ2	3151	GSSTIQELSSGNPV	-9.03915	-10.0745
HLA-A24:02	5HGA	3151	GSSTIQELSSGNPV	-6.56204	-6.67544
HLA-A24:02	5HGA	3151	GSSTIQELSSGNPV	-5.42271	-6.45801
HLA-B44:05	3DX8	3151	GSSTIQELSSGNPV	-7.85648	-8.89178
HLA-B44:05	3DX8	3151	GSSTIQELSSGNPV	-5.3978	-5.5112
HLA-A02:01	6TDR	3151	GSSTIQELSSGNPV	-3.37154	-4.40684
HLA-B14:02	3BVN	7430	QNNWDLVLSSGNPV	-7.15543	-7.26883
HLA-B14:02	3BVN	7430	QNNWDLVLSSGNPV	-4.77435	-5.80965
HLA-B52:01	3W39	7430	QNNWDLVLSSGNPV	-6.80875	-6.92215
HLA-B52:01	3W39	7430	QNNWDLVLSSGNPV	-4.20386	-5.23916
HLA-A11:01	4UQ2	7430	QNNWDLVLSSGNPV	-7.5194	-8.5547
HLA-A11:01	4UQ2	7430	QNNWDLVLSSGNPV	-6.9601	-7.0735
HLA-A24:02	5HGA	7430	QNNWDLVLSSGNPV	-7.52403	-7.63743
HLA-A24:02	5HGA	7430	QNNWDLVLSSGNPV	-5.82433	-6.85963
HLA-B27:05	6PYJ	7430	QNNWDLVLSSGNPV	-3.28285	-4.31815
HLA-B44:05	3DX8	7430	QNNWDLVLSSGNPV	-5.91172	-6.94702
HLA-B44:05	3DX8	7430	QNNWDLVLSSGNPV	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of FAF1-EPS15

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
FAF1-EPS15	chr1	51171458	chr1	51946986	10	21	IQELSSGNPVY	ATTCAAGAGTTATCAAGTGGGAATCCTGTATAT
FAF1-EPS15	chr1	51171458	chr1	51946986	11	20	QELSSGNPV	CAAGAGTTATCAAGTGGGAATCCTGTA
FAF1-EPS15	chr1	51171458	chr1	51946986	11	21	QELSSGNPVY	CAAGAGTTATCAAGTGGGAATCCTGTATAT
FAF1-EPS15	chr1	51171458	chr1	51946986	12	21	ELSSGNPVY	GAGTTATCAAGTGGGAATCCTGTATAT
FAF1-EPS15	chr1	51171458	chr1	51946986	5	14	SGSSTIQEL	TCAGGAAGCAGTACTATTCAAGAGTTA
FAF1-EPS15	chr1	51323600	chr1	51946986	10	21	DLVLSSGNPVY	GACTTAGTGTTATCAAGTGGGAATCCTGTATAT
FAF1-EPS15	chr1	51323600	chr1	51946986	11	21	LVLSSGNPVY	TTAGTGTTATCAAGTGGGAATCCTGTATAT
FAF1-EPS15	chr1	51323600	chr1	51946986	12	21	VLSSGNPVY	GTGTTATCAAGTGGGAATCCTGTATAT
FAF1-EPS15	chr1	51323600	chr1	51946986	5	14	EQNNWDLVL	GAACAAAATAATTGGGACTTAGTGTTA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
FAF1-EPS15	chr1	51171458	chr1	51946986	0	15	YNLNFSGSSTIQELS	TACAACCTGAACTTCTCAGGAAGCAGTACTATTCAAGAGTTATCA
FAF1-EPS15	chr1	51171458	chr1	51946986	1	16	NLNFSGSSTIQELSS	AACCTGAACTTCTCAGGAAGCAGTACTATTCAAGAGTTATCAAGT
FAF1-EPS15	chr1	51323600	chr1	51946986	7	22	NNWDLVLSSGNPVYE	AATAATTGGGACTTAGTGTTATCAAGTGGGAATCCTGTATATGAA
FAF1-EPS15	chr1	51323600	chr1	51946986	8	23	NWDLVLSSGNPVYEK	AATTGGGACTTAGTGTTATCAAGTGGGAATCCTGTATATGAAAAA

Top

Information of the samples that have these potential fusion neoantigens of FAF1-EPS15

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BLCA	FAF1-EPS15	chr1	51171458	ENST00000396153	chr1	51946986	ENST00000371730	TCGA-2F-A9KP-01A
STAD	FAF1-EPS15	chr1	51323600	ENST00000396153	chr1	51946986	ENST00000371730	TCGA-BR-A4QI

Top

Potential target of CAR-T therapy development for FAF1-EPS15

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to FAF1-EPS15

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to FAF1-EPS15

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)