![]() |
|||||||
|
Fusion Protein:FAM160B1-ATP2A2 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: FAM160B1-ATP2A2 | FusionPDB ID: 28620 | FusionGDB2.0 ID: 28620 | Hgene | Tgene | Gene symbol | FAM160B1 | ATP2A2 | Gene ID | 57700 | 488 |
Gene name | family with sequence similarity 160 member B1 | ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 2 | |
Synonyms | KIAA1600|bA106M7.3 | ATP2B|DAR|DD|SERCA2 | |
Cytomap | 10q25.3 | 12q24.11 | |
Type of gene | protein-coding | protein-coding | |
Description | protein FAM160B1 | sarcoplasmic/endoplasmic reticulum calcium ATPase 2ATPase Ca++ transporting cardiac muscle slow twitch 2ATPase, Ca++ dependent, slow-twitch, cardiac muscle-2SR Ca(2+)-ATPase 2calcium pump 2calcium-transporting ATPase sarcoplasmic reticulum type, slow | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | Q5W0V3 Main function of 5'-partner protein: | P16615 Main function of 5'-partner protein: FUNCTION: This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to the sarcoplasmic reticulum lumen (PubMed:16402920). Involved in autophagy in response to starvation. Upon interaction with VMP1 and activation, controls ER-isolation membrane contacts for autophagosome formation (PubMed:28890335). Also modulates ER contacts with lipid droplets, mitochondria and endosomes (PubMed:28890335). {ECO:0000269|PubMed:16402920, ECO:0000269|PubMed:28890335}.; FUNCTION: [Isoform 2]: Involved in the regulation of the contraction/relaxation cycle. Acts as a regulator of TNFSF11-mediated Ca(2+) signaling pathways via its interaction with TMEM64 which is critical for the TNFSF11-induced CREB1 activation and mitochondrial ROS generation necessary for proper osteoclast generation. Association between TMEM64 and SERCA2 in the ER leads to cytosolic Ca(2+) spiking for activation of NFATC1 and production of mitochondrial ROS, thereby triggering Ca(2+) signaling cascades that promote osteoclast differentiation and activation. {ECO:0000250|UniProtKB:O55143}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000369248, ENST00000369250, ENST00000369246, | ENST00000550248, ENST00000552636, ENST00000308664, ENST00000395494, ENST00000539276, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 7 X 5 X 5=175 | 19 X 23 X 6=2622 |
# samples | 7 | 23 | |
** MAII score | log2(7/175*10)=-1.32192809488736 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(23/2622*10)=-3.51096191927738 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: FAM160B1 [Title/Abstract] AND ATP2A2 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: FAM160B1 [Title/Abstract] AND ATP2A2 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | FAM160B1(116606126)-ATP2A2(110770401), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | FAM160B1-ATP2A2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FAM160B1-ATP2A2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Tgene | ATP2A2 | GO:0032469 | endoplasmic reticulum calcium ion homeostasis | 16402920 |
Tgene | ATP2A2 | GO:0032470 | positive regulation of endoplasmic reticulum calcium ion concentration | 16402920 |
Tgene | ATP2A2 | GO:0070588 | calcium ion transmembrane transport | 16402920 |
Tgene | ATP2A2 | GO:1903515 | calcium ion transport from cytosol to endoplasmic reticulum | 16402920 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr10:116606126/chr12:110770401) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000369250 | FAM160B1 | chr10 | 116606126 | + | ENST00000308664 | ATP2A2 | chr12 | 110770401 | + | 4417 | 1733 | 44 | 3631 | 1195 |
ENST00000369250 | FAM160B1 | chr10 | 116606126 | + | ENST00000395494 | ATP2A2 | chr12 | 110770401 | + | 8385 | 1733 | 44 | 3766 | 1240 |
ENST00000369250 | FAM160B1 | chr10 | 116606126 | + | ENST00000539276 | ATP2A2 | chr12 | 110770401 | + | 4623 | 1733 | 44 | 3766 | 1240 |
ENST00000369248 | FAM160B1 | chr10 | 116606126 | + | ENST00000308664 | ATP2A2 | chr12 | 110770401 | + | 4417 | 1733 | 44 | 3631 | 1195 |
ENST00000369248 | FAM160B1 | chr10 | 116606126 | + | ENST00000395494 | ATP2A2 | chr12 | 110770401 | + | 8385 | 1733 | 44 | 3766 | 1240 |
ENST00000369248 | FAM160B1 | chr10 | 116606126 | + | ENST00000539276 | ATP2A2 | chr12 | 110770401 | + | 4623 | 1733 | 44 | 3766 | 1240 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000369250 | ENST00000308664 | FAM160B1 | chr10 | 116606126 | + | ATP2A2 | chr12 | 110770401 | + | 0.000582591 | 0.9994174 |
ENST00000369250 | ENST00000395494 | FAM160B1 | chr10 | 116606126 | + | ATP2A2 | chr12 | 110770401 | + | 0.00021752 | 0.9997825 |
ENST00000369250 | ENST00000539276 | FAM160B1 | chr10 | 116606126 | + | ATP2A2 | chr12 | 110770401 | + | 0.000244181 | 0.9997558 |
ENST00000369248 | ENST00000308664 | FAM160B1 | chr10 | 116606126 | + | ATP2A2 | chr12 | 110770401 | + | 0.000582591 | 0.9994174 |
ENST00000369248 | ENST00000395494 | FAM160B1 | chr10 | 116606126 | + | ATP2A2 | chr12 | 110770401 | + | 0.00021752 | 0.9997825 |
ENST00000369248 | ENST00000539276 | FAM160B1 | chr10 | 116606126 | + | ATP2A2 | chr12 | 110770401 | + | 0.000244181 | 0.9997558 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for FAM160B1-ATP2A2 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
FAM160B1 | chr10 | 116606126 | ATP2A2 | chr12 | 110770401 | 1733 | 49 | RAARAHLKRPGQALPRSSARPPRPAP |
Top |
Potential FusionNeoAntigen Information of FAM160B1-ATP2A2 in HLA I |
![]() |
FAM160B1-ATP2A2_116606126_110770401.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B08:09 | QALPRSSA | 0.9976 | 0.7959 | 11 | 19 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B08:09 | HLKRPGQAL | 0.9953 | 0.7135 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B07:02 | HLKRPGQAL | 0.9933 | 0.5415 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B07:10 | HLKRPGQAL | 0.9931 | 0.5833 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B07:05 | HLKRPGQAL | 0.9925 | 0.5013 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B15:01 | HLKRPGQAL | 0.9872 | 0.7919 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B14:02 | HLKRPGQAL | 0.934 | 0.9171 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B14:01 | HLKRPGQAL | 0.934 | 0.9171 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-A31:02 | QALPRSSAR | 0.9025 | 0.5965 | 11 | 20 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B15:25 | HLKRPGQAL | 0.7947 | 0.844 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B15:02 | HLKRPGQAL | 0.7512 | 0.8612 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B50:01 | GQALPRSSA | 0.6176 | 0.8385 | 10 | 19 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B46:01 | HLKRPGQAL | 0.546 | 0.5364 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B48:01 | HLKRPGQAL | 0.2538 | 0.506 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B82:01 | HLKRPGQAL | 0.2405 | 0.5304 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B39:24 | AHLKRPGQAL | 0.9985 | 0.7114 | 4 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B39:01 | AHLKRPGQAL | 0.9978 | 0.8543 | 4 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B15:10 | AHLKRPGQAL | 0.9926 | 0.5508 | 4 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B38:02 | AHLKRPGQAL | 0.9877 | 0.9376 | 4 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B38:01 | AHLKRPGQAL | 0.9859 | 0.943 | 4 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B14:02 | AHLKRPGQAL | 0.9768 | 0.9085 | 4 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B14:01 | AHLKRPGQAL | 0.9768 | 0.9085 | 4 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B15:37 | AHLKRPGQAL | 0.9519 | 0.5874 | 4 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B15:18 | AHLKRPGQAL | 0.9371 | 0.6847 | 4 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B07:10 | AHLKRPGQAL | 0.8075 | 0.6266 | 4 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B48:01 | AHLKRPGQAL | 0.7935 | 0.6697 | 4 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B07:05 | RPGQALPRSSA | 0.9999 | 0.669 | 8 | 19 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B07:02 | RPGQALPRSSA | 0.9998 | 0.6271 | 8 | 19 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B15:04 | HLKRPGQAL | 0.9777 | 0.8105 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B07:12 | HLKRPGQAL | 0.972 | 0.7258 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B15:07 | HLKRPGQAL | 0.9694 | 0.6722 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-A31:01 | QALPRSSAR | 0.9623 | 0.5433 | 11 | 20 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B14:03 | HLKRPGQAL | 0.9438 | 0.8951 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B15:04 | GQALPRSSA | 0.8129 | 0.8926 | 10 | 19 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B15:21 | HLKRPGQAL | 0.7432 | 0.8327 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-C01:30 | HLKRPGQAL | 0.4419 | 0.9672 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B39:10 | HLKRPGQAL | 0.3402 | 0.8612 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B39:12 | HLKRPGQAL | 0.2994 | 0.8589 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B39:09 | AHLKRPGQAL | 0.9979 | 0.7876 | 4 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B39:12 | AHLKRPGQAL | 0.9971 | 0.8556 | 4 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B39:05 | AHLKRPGQAL | 0.9857 | 0.8386 | 4 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B14:03 | AHLKRPGQAL | 0.946 | 0.9018 | 4 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B48:03 | AHLKRPGQAL | 0.5233 | 0.5759 | 4 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B07:04 | RAHLKRPGQAL | 0.9992 | 0.7029 | 3 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B07:12 | RPGQALPRSSA | 0.9991 | 0.7472 | 8 | 19 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B07:04 | RPGQALPRSSA | 0.9988 | 0.6357 | 8 | 19 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B42:02 | RPGQALPRSSA | 0.9914 | 0.7112 | 8 | 19 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B42:01 | RPGQALPRSSA | 0.9894 | 0.7015 | 8 | 19 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B07:13 | HLKRPGQAL | 0.9945 | 0.8792 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B07:09 | HLKRPGQAL | 0.9941 | 0.5483 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B07:22 | HLKRPGQAL | 0.9933 | 0.5415 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B48:05 | HLKRPGQAL | 0.9923 | 0.5303 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B15:34 | HLKRPGQAL | 0.9872 | 0.7919 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B15:33 | HLKRPGQAL | 0.9872 | 0.7919 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B15:125 | HLKRPGQAL | 0.9872 | 0.7919 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B15:135 | HLKRPGQAL | 0.9868 | 0.7988 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B15:27 | HLKRPGQAL | 0.9867 | 0.8389 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B15:35 | HLKRPGQAL | 0.9783 | 0.8103 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B15:68 | HLKRPGQAL | 0.9742 | 0.6388 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B15:50 | HLKRPGQAL | 0.9648 | 0.893 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-A02:03 | HLKRPGQAL | 0.9636 | 0.6515 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B15:73 | HLKRPGQAL | 0.9033 | 0.87 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-C03:05 | HLKRPGQAL | 0.8535 | 0.9074 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-C03:67 | HLKRPGQAL | 0.831 | 0.9652 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B15:30 | HLKRPGQAL | 0.8233 | 0.881 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B08:12 | HLKRPGQAL | 0.813 | 0.6369 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B15:39 | HLKRPGQAL | 0.7977 | 0.7897 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B15:12 | HLKRPGQAL | 0.7977 | 0.7507 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-C07:04 | HLKRPGQAL | 0.7756 | 0.9707 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B50:04 | GQALPRSSA | 0.6176 | 0.8385 | 10 | 19 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B50:05 | GQALPRSSA | 0.6176 | 0.8385 | 10 | 19 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-C01:02 | HLKRPGQAL | 0.6138 | 0.9688 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B48:05 | GQALPRSSA | 0.5953 | 0.6195 | 10 | 19 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B39:02 | HLKRPGQAL | 0.3038 | 0.8714 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B82:02 | HLKRPGQAL | 0.2405 | 0.5304 | 5 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B39:02 | AHLKRPGQAL | 0.9977 | 0.8701 | 4 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B39:31 | AHLKRPGQAL | 0.9971 | 0.8547 | 4 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B38:05 | AHLKRPGQAL | 0.9859 | 0.943 | 4 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B15:09 | AHLKRPGQAL | 0.944 | 0.7688 | 4 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B48:05 | AHLKRPGQAL | 0.8931 | 0.5271 | 4 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B39:11 | AHLKRPGQAL | 0.8889 | 0.8973 | 4 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B15:30 | AHLKRPGQAL | 0.8528 | 0.9223 | 4 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B15:73 | AHLKRPGQAL | 0.8495 | 0.9109 | 4 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B40:12 | AHLKRPGQAL | 0.5233 | 0.5759 | 4 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B07:09 | RPGQALPRSSA | 0.9999 | 0.6423 | 8 | 19 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B07:13 | RAHLKRPGQAL | 0.9999 | 0.9101 | 3 | 14 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B07:22 | RPGQALPRSSA | 0.9998 | 0.6271 | 8 | 19 |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 | HLA-B48:05 | RAHLKRPGQAL | 0.9998 | 0.5754 | 3 | 14 |
Top |
Potential FusionNeoAntigen Information of FAM160B1-ATP2A2 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of FAM160B1-ATP2A2 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
5177 | LKRPGQALPRSSAR | FAM160B1 | ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 1733 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of FAM160B1-ATP2A2 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 5177 | LKRPGQALPRSSAR | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 5177 | LKRPGQALPRSSAR | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 5177 | LKRPGQALPRSSAR | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 5177 | LKRPGQALPRSSAR | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 5177 | LKRPGQALPRSSAR | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 5177 | LKRPGQALPRSSAR | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 5177 | LKRPGQALPRSSAR | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 5177 | LKRPGQALPRSSAR | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 5177 | LKRPGQALPRSSAR | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 5177 | LKRPGQALPRSSAR | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 5177 | LKRPGQALPRSSAR | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of FAM160B1-ATP2A2 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 10 | 19 | GQALPRSSA | TCTGATGAGATGTTCATTCTGGACAGA |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 11 | 19 | QALPRSSA | GATGAGATGTTCATTCTGGACAGA |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 11 | 20 | QALPRSSAR | GATGAGATGTTCATTCTGGACAGAGTG |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 3 | 14 | RAHLKRPGQAL | ATTGAACATTGTGATCACATATCTGATGAGATG |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 4 | 14 | AHLKRPGQAL | GAACATTGTGATCACATATCTGATGAGATG |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 5 | 14 | HLKRPGQAL | CATTGTGATCACATATCTGATGAGATG |
FAM160B1-ATP2A2 | chr10 | 116606126 | chr12 | 110770401 | 8 | 19 | RPGQALPRSSA | CACATATCTGATGAGATGTTCATTCTGGACAGA |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of FAM160B1-ATP2A2 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
BRCA | FAM160B1-ATP2A2 | chr10 | 116606126 | ENST00000369248 | chr12 | 110770401 | ENST00000308664 | TCGA-A8-A08F |
Top |
Potential target of CAR-T therapy development for FAM160B1-ATP2A2 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Tgene | ATP2A2 | chr10:116606126 | chr12:110770401 | ENST00000308664 | 7 | 21 | 757_776 | 0 | 998.0 | Transmembrane | Helical%3B Name%3D5 | |
Tgene | ATP2A2 | chr10:116606126 | chr12:110770401 | ENST00000308664 | 7 | 21 | 828_850 | 0 | 998.0 | Transmembrane | Helical%3B Name%3D7 | |
Tgene | ATP2A2 | chr10:116606126 | chr12:110770401 | ENST00000308664 | 7 | 21 | 897_916 | 0 | 998.0 | Transmembrane | Helical%3B Name%3D8 | |
Tgene | ATP2A2 | chr10:116606126 | chr12:110770401 | ENST00000308664 | 7 | 21 | 930_948 | 0 | 998.0 | Transmembrane | Helical%3B Name%3D9 | |
Tgene | ATP2A2 | chr10:116606126 | chr12:110770401 | ENST00000308664 | 7 | 21 | 964_984 | 0 | 998.0 | Transmembrane | Helical%3B Name%3D10 | |
Tgene | ATP2A2 | chr10:116606126 | chr12:110770401 | ENST00000395494 | 6 | 19 | 757_776 | 0 | 1016.0 | Transmembrane | Helical%3B Name%3D5 | |
Tgene | ATP2A2 | chr10:116606126 | chr12:110770401 | ENST00000395494 | 6 | 19 | 828_850 | 0 | 1016.0 | Transmembrane | Helical%3B Name%3D7 | |
Tgene | ATP2A2 | chr10:116606126 | chr12:110770401 | ENST00000395494 | 6 | 19 | 897_916 | 0 | 1016.0 | Transmembrane | Helical%3B Name%3D8 | |
Tgene | ATP2A2 | chr10:116606126 | chr12:110770401 | ENST00000395494 | 6 | 19 | 930_948 | 0 | 1016.0 | Transmembrane | Helical%3B Name%3D9 | |
Tgene | ATP2A2 | chr10:116606126 | chr12:110770401 | ENST00000395494 | 6 | 19 | 964_984 | 0 | 1016.0 | Transmembrane | Helical%3B Name%3D10 | |
Tgene | ATP2A2 | chr10:116606126 | chr12:110770401 | ENST00000539276 | 7 | 20 | 757_776 | 0 | 1043.0 | Transmembrane | Helical%3B Name%3D5 | |
Tgene | ATP2A2 | chr10:116606126 | chr12:110770401 | ENST00000539276 | 7 | 20 | 828_850 | 0 | 1043.0 | Transmembrane | Helical%3B Name%3D7 | |
Tgene | ATP2A2 | chr10:116606126 | chr12:110770401 | ENST00000539276 | 7 | 20 | 897_916 | 0 | 1043.0 | Transmembrane | Helical%3B Name%3D8 | |
Tgene | ATP2A2 | chr10:116606126 | chr12:110770401 | ENST00000539276 | 7 | 20 | 930_948 | 0 | 1043.0 | Transmembrane | Helical%3B Name%3D9 | |
Tgene | ATP2A2 | chr10:116606126 | chr12:110770401 | ENST00000539276 | 7 | 20 | 964_984 | 0 | 1043.0 | Transmembrane | Helical%3B Name%3D10 |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to FAM160B1-ATP2A2 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to FAM160B1-ATP2A2 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |