![]() |
|||||||
|
Fusion Protein:FAM35A-BMPR1A |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: FAM35A-BMPR1A | FusionPDB ID: 29013 | FusionGDB2.0 ID: 29013 | Hgene | Tgene | Gene symbol | FAM35A | BMPR1A | Gene ID | 54537 | 657 |
Gene name | shieldin complex subunit 2 | bone morphogenetic protein receptor type 1A | |
Synonyms | FAM35A|FAM35A1|RINN2|bA163M19.1 | 10q23del|ACVRLK3|ALK3|CD292|SKR5 | |
Cytomap | 10q23.2 | 10q23.2 | |
Type of gene | protein-coding | protein-coding | |
Description | shieldin complex subunit 2RINN1-REV7-interacting novel NHEJ regulator 2family with sequence similarity 35 member Aprotein FAM35Ashield complex subunit 2 | bone morphogenetic protein receptor type-1AALK-3BMP type-1A receptorBMPR-1Aactivin A receptor, type II-like kinase 3activin receptor-like kinase 3bone morphogenetic protein receptor, type IAserine/threonine-protein kinase receptor R5 | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | . | P36894 Main function of 5'-partner protein: FUNCTION: On ligand binding, forms a receptor complex consisting of two type II and two type I transmembrane serine/threonine kinases. Type II receptors phosphorylate and activate type I receptors which autophosphorylate, then bind and activate SMAD transcriptional regulators. Receptor for BMP2, BMP4, GDF5 and GDF6. Positively regulates chondrocyte differentiation through GDF5 interaction. Mediates induction of adipogenesis by GDF6. {ECO:0000250|UniProtKB:P36895}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000298784, ENST00000298786, | ENST00000480152, ENST00000372037, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 5 X 4 X 4=80 | 4 X 4 X 2=32 |
# samples | 6 | 4 | |
** MAII score | log2(6/80*10)=-0.415037499278844 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(4/32*10)=0.321928094887362 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | |
Fusion gene context | PubMed: FAM35A [Title/Abstract] AND BMPR1A [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: FAM35A [Title/Abstract] AND BMPR1A [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | FAM35A(88912636)-BMPR1A(88649819), # samples:2 BMPR1A(88635842)-FAM35A(88911107), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | FAM35A-BMPR1A seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FAM35A-BMPR1A seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FAM35A-BMPR1A seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. FAM35A-BMPR1A seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | FAM35A | GO:0045830 | positive regulation of isotype switching | 29656893 |
Hgene | FAM35A | GO:2000042 | negative regulation of double-strand break repair via homologous recombination | 29656893 |
Hgene | FAM35A | GO:2001034 | positive regulation of double-strand break repair via nonhomologous end joining | 29656893|29789392 |
Tgene | BMPR1A | GO:0006468 | protein phosphorylation | 12065756 |
Tgene | BMPR1A | GO:0010862 | positive regulation of pathway-restricted SMAD protein phosphorylation | 9389648|24904118 |
Tgene | BMPR1A | GO:0030509 | BMP signaling pathway | 9389648|18436533 |
Tgene | BMPR1A | GO:0060391 | positive regulation of SMAD protein signal transduction | 9389648 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr10:88912636/chr10:88649819) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000298784 | FAM35A | chr10 | 88912636 | + | ENST00000372037 | BMPR1A | chr10 | 88649819 | + | 12290 | 1639 | 114 | 3170 | 1018 |
ENST00000298786 | FAM35A | chr10 | 88912636 | + | ENST00000372037 | BMPR1A | chr10 | 88649819 | + | 12290 | 1639 | 114 | 3170 | 1018 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000298784 | ENST00000372037 | FAM35A | chr10 | 88912636 | + | BMPR1A | chr10 | 88649819 | + | 5.79E-05 | 0.99994206 |
ENST00000298786 | ENST00000372037 | FAM35A | chr10 | 88912636 | + | BMPR1A | chr10 | 88649819 | + | 5.79E-05 | 0.99994206 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for FAM35A-BMPR1A |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
FAM35A | chr10 | 88912636 | BMPR1A | chr10 | 88649819 | 1639 | 508 | AFTVFLGDIILLTGQNLDSMLHGTGM |
Top |
Potential FusionNeoAntigen Information of FAM35A-BMPR1A in HLA I |
![]() |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Potential FusionNeoAntigen Information of FAM35A-BMPR1A in HLA II |
![]() |
FAM35A-BMPR1A_88912636_88649819.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0101 | FLGDIILLTGQNLDS | 4 | 19 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0101 | LGDIILLTGQNLDSM | 5 | 20 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0101 | GDIILLTGQNLDSML | 6 | 21 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0102 | FLGDIILLTGQNLDS | 4 | 19 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0102 | GDIILLTGQNLDSML | 6 | 21 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0102 | LGDIILLTGQNLDSM | 5 | 20 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0105 | FLGDIILLTGQNLDS | 4 | 19 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0105 | LGDIILLTGQNLDSM | 5 | 20 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0105 | GDIILLTGQNLDSML | 6 | 21 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0107 | FLGDIILLTGQNLDS | 4 | 19 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0107 | LGDIILLTGQNLDSM | 5 | 20 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0107 | GDIILLTGQNLDSML | 6 | 21 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0111 | FLGDIILLTGQNLDS | 4 | 19 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0111 | LGDIILLTGQNLDSM | 5 | 20 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0111 | GDIILLTGQNLDSML | 6 | 21 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0111 | VFLGDIILLTGQNLD | 3 | 18 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0115 | FLGDIILLTGQNLDS | 4 | 19 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0119 | FLGDIILLTGQNLDS | 4 | 19 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0119 | LGDIILLTGQNLDSM | 5 | 20 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0119 | GDIILLTGQNLDSML | 6 | 21 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0125 | FLGDIILLTGQNLDS | 4 | 19 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0125 | LGDIILLTGQNLDSM | 5 | 20 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0125 | GDIILLTGQNLDSML | 6 | 21 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0127 | FLGDIILLTGQNLDS | 4 | 19 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0127 | LGDIILLTGQNLDSM | 5 | 20 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0127 | GDIILLTGQNLDSML | 6 | 21 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0129 | FLGDIILLTGQNLDS | 4 | 19 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0129 | LGDIILLTGQNLDSM | 5 | 20 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0129 | GDIILLTGQNLDSML | 6 | 21 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0131 | FLGDIILLTGQNLDS | 4 | 19 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0131 | LGDIILLTGQNLDSM | 5 | 20 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-0131 | GDIILLTGQNLDSML | 6 | 21 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB1-1521 | FLGDIILLTGQNLDS | 4 | 19 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB4-0101 | IILLTGQNLDSMLHG | 8 | 23 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB4-0103 | IILLTGQNLDSMLHG | 8 | 23 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB4-0106 | IILLTGQNLDSMLHG | 8 | 23 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB4-0107 | IILLTGQNLDSMLHG | 8 | 23 |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 1639 | DRB4-0108 | IILLTGQNLDSMLHG | 8 | 23 |
Top |
Fusion breakpoint peptide structures of FAM35A-BMPR1A |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of FAM35A-BMPR1A |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
Top |
Vaccine Design for the FusionNeoAntigens of FAM35A-BMPR1A |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 3 | 18 | VFLGDIILLTGQNLD | TGTTTCTTGGAGATATAATTTTACTCACAGGACAGAATCTGGATA |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 4 | 19 | FLGDIILLTGQNLDS | TTCTTGGAGATATAATTTTACTCACAGGACAGAATCTGGATAGTA |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 5 | 20 | LGDIILLTGQNLDSM | TTGGAGATATAATTTTACTCACAGGACAGAATCTGGATAGTATGC |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 6 | 21 | GDIILLTGQNLDSML | GAGATATAATTTTACTCACAGGACAGAATCTGGATAGTATGCTTC |
FAM35A-BMPR1A | chr10 | 88912636 | chr10 | 88649819 | 8 | 23 | IILLTGQNLDSMLHG | TAATTTTACTCACAGGACAGAATCTGGATAGTATGCTTCATGGCA |
Top |
Information of the samples that have these potential fusion neoantigens of FAM35A-BMPR1A |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
Top |
Potential target of CAR-T therapy development for FAM35A-BMPR1A |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Tgene | BMPR1A | chr10:88912636 | chr10:88649819 | ENST00000372037 | 2 | 13 | 153_176 | 0 | 533.0 | Transmembrane | Helical |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to FAM35A-BMPR1A |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to FAM35A-BMPR1A |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |