![]() |
|||||||
|
Fusion Protein:FBXW11-STK10 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: FBXW11-STK10 | FusionPDB ID: 29890 | FusionGDB2.0 ID: 29890 | Hgene | Tgene | Gene symbol | FBXW11 | STK10 | Gene ID | 23291 | 6793 |
Gene name | F-box and WD repeat domain containing 11 | serine/threonine kinase 10 | |
Synonyms | BTRC2|BTRCP2|FBW1B|FBXW1B|Fbw11|Hos | LOK|PRO2729 | |
Cytomap | 5q35.1 | 5q35.1 | |
Type of gene | protein-coding | protein-coding | |
Description | F-box/WD repeat-containing protein 11F-box and WD repeats protein beta-TrCP2F-box and WD-40 domain protein 11F-box and WD-40 domain protein 1BF-box protein Fbw1bF-box/WD repeat-containing protein 1Bbeta-transducin repeat-containing protein 2homolog | serine/threonine-protein kinase 10lymphocyte-oriented kinase | |
Modification date | 20200329 | 20200313 | |
UniProtAcc | Q9UKB1 Main function of 5'-partner protein: FUNCTION: Substrate recognition component of a SCF (SKP1-CUL1-F-box protein) E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. Probably recognizes and binds to phosphorylated target proteins. SCF(FBXW11) mediates the ubiquitination of phosphorylated CTNNB1 and participates in Wnt signaling. SCF(FBXW11) mediates the ubiquitination of phosphorylated NFKBIA, which degradation frees the associated NFKB1 to translocate into the nucleus and to activate transcription. SCF(FBXW11) mediates the ubiquitination of IFNAR1. SCF(FBXW11) mediates the ubiquitination of CEP68; this is required for centriole separation during mitosis (PubMed:25503564). Involved in the oxidative stress-induced a ubiquitin-mediated decrease in RCAN1. Mediates the degradation of CDC25A induced by ionizing radiation in cells progressing through S phase and thus may function in the intra-S-phase checkpoint. Has an essential role in the control of the clock-dependent transcription via degradation of phosphorylated PER1 and phosphorylated PER2. SCF(FBXW11) mediates the ubiquitination of CYTH1, and probably CYTH2 (PubMed:29420262). {ECO:0000269|PubMed:10321728, ECO:0000269|PubMed:10437795, ECO:0000269|PubMed:10644755, ECO:0000269|PubMed:10648623, ECO:0000269|PubMed:14532120, ECO:0000269|PubMed:14603323, ECO:0000269|PubMed:15917222, ECO:0000269|PubMed:18575781, ECO:0000269|PubMed:19966869, ECO:0000269|PubMed:20347421, ECO:0000269|PubMed:25503564, ECO:0000269|PubMed:29420262}.; FUNCTION: (Microbial infection) Target of human immunodeficiency virus type 1 (HIV-1) protein VPU to polyubiquitinate and deplete BST2 from cells and antagonize its antiviral action. {ECO:0000269|PubMed:19730691}. | . | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000265094, ENST00000296933, ENST00000393802, ENST00000425623, ENST00000522891, | ENST00000517775, ENST00000176763, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 13 X 6 X 9=702 | 16 X 15 X 7=1680 |
# samples | 13 | 17 | |
** MAII score | log2(13/702*10)=-2.43295940727611 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(17/1680*10)=-3.30485458152842 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: FBXW11 [Title/Abstract] AND STK10 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: FBXW11 [Title/Abstract] AND STK10 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | FBXW11(171433462)-STK10(171554425), # samples:1 FBXW11(171423894)-STK10(171554425), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | FBXW11-STK10 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FBXW11-STK10 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FBXW11-STK10 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. FBXW11-STK10 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | FBXW11 | GO:0000209 | protein polyubiquitination | 20347421 |
Hgene | FBXW11 | GO:0016567 | protein ubiquitination | 16885022 |
Hgene | FBXW11 | GO:0031146 | SCF-dependent proteasomal ubiquitin-dependent protein catabolic process | 20347421 |
Hgene | FBXW11 | GO:0043161 | proteasome-mediated ubiquitin-dependent protein catabolic process | 20347421 |
Tgene | STK10 | GO:0046777 | protein autophosphorylation | 12639966|18239682 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr5:171433462/chr5:171554425) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000296933 | FBXW11 | chr5 | 171433462 | - | ENST00000176763 | STK10 | chr5 | 171554425 | - | 5811 | 416 | 290 | 3001 | 903 |
ENST00000265094 | FBXW11 | chr5 | 171433462 | - | ENST00000176763 | STK10 | chr5 | 171554425 | - | 5578 | 183 | 57 | 2768 | 903 |
ENST00000393802 | FBXW11 | chr5 | 171433462 | - | ENST00000176763 | STK10 | chr5 | 171554425 | - | 5588 | 193 | 67 | 2778 | 903 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000296933 | ENST00000176763 | FBXW11 | chr5 | 171433462 | - | STK10 | chr5 | 171554425 | - | 0.007812285 | 0.99218774 |
ENST00000265094 | ENST00000176763 | FBXW11 | chr5 | 171433462 | - | STK10 | chr5 | 171554425 | - | 0.008022741 | 0.9919773 |
ENST00000393802 | ENST00000176763 | FBXW11 | chr5 | 171433462 | - | STK10 | chr5 | 171554425 | - | 0.008025212 | 0.9919748 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for FBXW11-STK10 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
FBXW11 | chr5 | 171433462 | STK10 | chr5 | 171554425 | 183 | 40 | MEPDSVIEDKTIELMIMIEFCPGGAV |
FBXW11 | chr5 | 171433462 | STK10 | chr5 | 171554425 | 193 | 40 | MEPDSVIEDKTIELMIMIEFCPGGAV |
FBXW11 | chr5 | 171433462 | STK10 | chr5 | 171554425 | 416 | 40 | MEPDSVIEDKTIELMIMIEFCPGGAV |
Top |
Potential FusionNeoAntigen Information of FBXW11-STK10 in HLA I |
![]() |
FBXW11-STK10_171433462_171554425.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-B18:01 | IELMIMIEF | 0.997 | 0.8377 | 11 | 20 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-B58:01 | KTIELMIMI | 0.9963 | 0.7262 | 9 | 18 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-B57:01 | KTIELMIMI | 0.9951 | 0.8179 | 9 | 18 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-B58:02 | KTIELMIMI | 0.9943 | 0.7462 | 9 | 18 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-B57:03 | KTIELMIMI | 0.9943 | 0.8341 | 9 | 18 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-B15:16 | KTIELMIMI | 0.9938 | 0.619 | 9 | 18 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-B15:17 | KTIELMIMI | 0.9937 | 0.7388 | 9 | 18 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-B44:03 | IELMIMIEF | 0.9882 | 0.9207 | 11 | 20 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-A30:08 | KTIELMIMI | 0.9844 | 0.6116 | 9 | 18 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-A32:13 | KTIELMIMI | 0.9809 | 0.9179 | 9 | 18 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-B13:02 | KTIELMIMI | 0.688 | 0.5314 | 9 | 18 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-B57:01 | KTIELMIMIEF | 0.9999 | 0.9288 | 9 | 20 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-B57:03 | KTIELMIMIEF | 0.9995 | 0.9356 | 9 | 20 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-C15:04 | KTIELMIMI | 0.999 | 0.907 | 9 | 18 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-C15:06 | KTIELMIMI | 0.9988 | 0.896 | 9 | 18 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-C15:02 | KTIELMIMI | 0.9992 | 0.9003 | 9 | 18 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-C15:09 | KTIELMIMI | 0.999 | 0.907 | 9 | 18 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-C15:05 | KTIELMIMI | 0.9989 | 0.9128 | 9 | 18 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-B18:07 | IELMIMIEF | 0.9978 | 0.7991 | 11 | 20 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-B18:04 | IELMIMIEF | 0.9976 | 0.8571 | 11 | 20 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-B18:08 | IELMIMIEF | 0.9971 | 0.7638 | 11 | 20 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-B18:05 | IELMIMIEF | 0.997 | 0.8377 | 11 | 20 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-B18:06 | IELMIMIEF | 0.9966 | 0.8361 | 11 | 20 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-B18:03 | IELMIMIEF | 0.9957 | 0.8309 | 11 | 20 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-B57:10 | KTIELMIMI | 0.9951 | 0.8179 | 9 | 18 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-B58:06 | KTIELMIMI | 0.9949 | 0.6409 | 9 | 18 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-A32:01 | KTIELMIMI | 0.9927 | 0.9319 | 9 | 18 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-B44:26 | IELMIMIEF | 0.9882 | 0.9207 | 11 | 20 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-B44:13 | IELMIMIEF | 0.9882 | 0.9207 | 11 | 20 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-B44:07 | IELMIMIEF | 0.9882 | 0.9207 | 11 | 20 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-B18:11 | IELMIMIEF | 0.9672 | 0.76 | 11 | 20 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-A69:01 | KTIELMIMI | 0.9364 | 0.5531 | 9 | 18 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-B48:02 | IELMIMIEF | 0.5963 | 0.7943 | 11 | 20 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | HLA-B57:10 | KTIELMIMIEF | 0.9999 | 0.9288 | 9 | 20 |
Top |
Potential FusionNeoAntigen Information of FBXW11-STK10 in HLA II |
![]() |
FBXW11-STK10_171433462_171554425.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | DRB1-0310 | EPDSVIEDKTIELMI | 1 | 16 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | DRB1-0310 | PDSVIEDKTIELMIM | 2 | 17 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | DRB1-1476 | EPDSVIEDKTIELMI | 1 | 16 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | DRB1-1476 | PDSVIEDKTIELMIM | 2 | 17 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | DRB1-1476 | MEPDSVIEDKTIELM | 0 | 15 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | DRB1-1479 | EPDSVIEDKTIELMI | 1 | 16 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | DRB1-1479 | PDSVIEDKTIELMIM | 2 | 17 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | DRB1-1479 | MEPDSVIEDKTIELM | 0 | 15 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | DRB1-1525 | EPDSVIEDKTIELMI | 1 | 16 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | DRB1-1525 | PDSVIEDKTIELMIM | 2 | 17 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | DRB3-0101 | EPDSVIEDKTIELMI | 1 | 16 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | DRB3-0101 | PDSVIEDKTIELMIM | 2 | 17 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | DRB3-0104 | EPDSVIEDKTIELMI | 1 | 16 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | DRB3-0104 | PDSVIEDKTIELMIM | 2 | 17 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | DRB3-0105 | EPDSVIEDKTIELMI | 1 | 16 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | DRB3-0105 | PDSVIEDKTIELMIM | 2 | 17 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | DRB3-0108 | EPDSVIEDKTIELMI | 1 | 16 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | DRB3-0108 | PDSVIEDKTIELMIM | 2 | 17 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | DRB3-0111 | EPDSVIEDKTIELMI | 1 | 16 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | DRB3-0111 | PDSVIEDKTIELMIM | 2 | 17 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | DRB3-0112 | EPDSVIEDKTIELMI | 1 | 16 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | DRB3-0112 | PDSVIEDKTIELMIM | 2 | 17 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | DRB3-0113 | EPDSVIEDKTIELMI | 1 | 16 |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 | DRB3-0113 | PDSVIEDKTIELMIM | 2 | 17 |
Top |
Fusion breakpoint peptide structures of FBXW11-STK10 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
3638 | IEDKTIELMIMIEF | FBXW11 | STK10 | chr5 | 171433462 | chr5 | 171554425 | 183 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of FBXW11-STK10 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 3638 | IEDKTIELMIMIEF | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 3638 | IEDKTIELMIMIEF | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 3638 | IEDKTIELMIMIEF | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 3638 | IEDKTIELMIMIEF | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 3638 | IEDKTIELMIMIEF | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 3638 | IEDKTIELMIMIEF | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 3638 | IEDKTIELMIMIEF | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 3638 | IEDKTIELMIMIEF | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 3638 | IEDKTIELMIMIEF | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 3638 | IEDKTIELMIMIEF | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 3638 | IEDKTIELMIMIEF | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of FBXW11-STK10 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 11 | 20 | IELMIMIEF | CTCATGATCATGATTGAGTTCTGTCCA |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 9 | 18 | KTIELMIMI | ATCGAGCTCATGATCATGATTGAGTTC |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 9 | 20 | KTIELMIMIEF | ATCGAGCTCATGATCATGATTGAGTTCTGTCCA |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 0 | 15 | MEPDSVIEDKTIELM | CCCGACTCGGTGATTGAGGACAAGACCATCGAGCTCATGATCATG |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 1 | 16 | EPDSVIEDKTIELMI | GACTCGGTGATTGAGGACAAGACCATCGAGCTCATGATCATGATT |
FBXW11-STK10 | chr5 | 171433462 | chr5 | 171554425 | 2 | 17 | PDSVIEDKTIELMIM | TCGGTGATTGAGGACAAGACCATCGAGCTCATGATCATGATTGAG |
Top |
Information of the samples that have these potential fusion neoantigens of FBXW11-STK10 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
OV | FBXW11-STK10 | chr5 | 171433462 | ENST00000265094 | chr5 | 171554425 | ENST00000176763 | TCGA-61-2000-01A |
Top |
Potential target of CAR-T therapy development for FBXW11-STK10 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to FBXW11-STK10 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to FBXW11-STK10 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |