![]() |
|||||||
|
Fusion Protein:FBXW7-ARFIP1 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: FBXW7-ARFIP1 | FusionPDB ID: 29912 | FusionGDB2.0 ID: 29912 | Hgene | Tgene | Gene symbol | FBXW7 | ARFIP1 | Gene ID | 55294 | 27236 |
Gene name | F-box and WD repeat domain containing 7 | ADP ribosylation factor interacting protein 1 | |
Synonyms | AGO|CDC4|FBW6|FBW7|FBX30|FBXO30|FBXW6|SEL-10|SEL10|hAgo|hCdc4 | HSU52521 | |
Cytomap | 4q31.3 | 4q31.3 | |
Type of gene | protein-coding | protein-coding | |
Description | F-box/WD repeat-containing protein 7F-box and WD repeat domain containing 7, E3 ubiquitin protein ligaseF-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)F-box protein FBW7F-box protein FBX30F-box protein SEL-10archipelagohomolog of | arfaptin-1 | |
Modification date | 20200327 | 20200313 | |
UniProtAcc | Q969H0 Main function of 5'-partner protein: FUNCTION: Substrate recognition component of a SCF (SKP1-CUL1-F-box protein) E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. Recognizes and binds phosphorylated sites/phosphodegrons within target proteins and thereafter bring them to the SCF complex for ubiquitination (PubMed:22748924, PubMed:17434132, PubMed:26976582, PubMed:28727686). Identified substrates include cyclin-E (CCNE1 or CCNE2), DISC1, JUN, MYC, NOTCH1 released notch intracellular domain (NICD), NOTCH2, MCL1, and probably PSEN1 (PubMed:11565034, PubMed:12354302, PubMed:11585921, PubMed:15103331, PubMed:14739463, PubMed:17558397, PubMed:17873522, PubMed:22608923, PubMed:22748924, PubMed:29149593, PubMed:25775507, PubMed:28007894, PubMed:26976582, PubMed:28727686). Acts as a negative regulator of JNK signaling by binding to phosphorylated JUN and promoting its ubiquitination and subsequent degradation (PubMed:14739463). SCF(FBXW7) complex mediates the ubiquitination and subsequent degradation of NFE2L1 (By similarity). Involved in bone homeostasis and negative regulation of osteoclast differentiation (PubMed:29149593). Regulates the amplitude of the cyclic expression of hepatic core clock genes and genes involved in lipid and glucose metabolism via ubiquitination and proteasomal degradation of their transcriptional repressor NR1D1; CDK1-dependent phosphorylation of NR1D1 is necessary for SCF(FBXW7)-mediated ubiquitination (PubMed:27238018). {ECO:0000250|UniProtKB:Q8VBV4, ECO:0000269|PubMed:11565034, ECO:0000269|PubMed:11585921, ECO:0000269|PubMed:14739463, ECO:0000269|PubMed:15103331, ECO:0000269|PubMed:17434132, ECO:0000269|PubMed:17558397, ECO:0000269|PubMed:17873522, ECO:0000269|PubMed:22608923, ECO:0000269|PubMed:22748924, ECO:0000269|PubMed:25775507, ECO:0000269|PubMed:26976582, ECO:0000269|PubMed:27238018, ECO:0000269|PubMed:28007894, ECO:0000269|PubMed:28727686, ECO:0000269|PubMed:29149593, ECO:0000305|PubMed:12354302}. | P53367 Main function of 5'-partner protein: FUNCTION: Plays a role in controlling biogenesis of secretory granules at the trans-Golgi network (PubMed:22981988). Mechanisitically, binds ARF-GTP at the neck of a growing secretory granule precursor and forms a protective scaffold (PubMed:9038142, PubMed:22981988). Once the granule precursor has been completely loaded, active PRKD1 phosphorylates ARFIP1 and releases it from ARFs (PubMed:22981988). In turn, ARFs induce fission (PubMed:22981988). Through this mechanism, ensures proper secretory granule formation at the Golgi of pancreatic beta cells (PubMed:22981988). {ECO:0000269|PubMed:22981988, ECO:0000269|PubMed:9038142}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000263981, ENST00000281708, ENST00000296555, ENST00000393956, ENST00000603548, ENST00000603841, ENST00000604095, ENST00000604872, | ENST00000511289, ENST00000353617, ENST00000356064, ENST00000405727, ENST00000451320, ENST00000429148, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 15 X 9 X 10=1350 | 10 X 10 X 11=1100 |
# samples | 17 | 19 | |
** MAII score | log2(17/1350*10)=-2.98935275580049 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(19/1100*10)=-2.53343220008107 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: FBXW7 [Title/Abstract] AND ARFIP1 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: FBXW7 [Title/Abstract] AND ARFIP1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | ARFIP1(153701378)-FBXW7(153271276), # samples:1 FBXW7(153268082)-ARFIP1(153831216), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | FBXW7-ARFIP1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FBXW7-ARFIP1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. FBXW7-ARFIP1 seems lost the major protein functional domain in Hgene partner, which is a cell metabolism gene due to the frame-shifted ORF. FBXW7-ARFIP1 seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. FBXW7-ARFIP1 seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | FBXW7 | GO:0016567 | protein ubiquitination | 12354302|15103331 |
Hgene | FBXW7 | GO:0031146 | SCF-dependent proteasomal ubiquitin-dependent protein catabolic process | 15103331|17434132 |
Hgene | FBXW7 | GO:0031398 | positive regulation of protein ubiquitination | 12628165 |
Hgene | FBXW7 | GO:0045741 | positive regulation of epidermal growth factor-activated receptor activity | 20208556 |
Hgene | FBXW7 | GO:0050821 | protein stabilization | 20208556 |
Hgene | FBXW7 | GO:0051443 | positive regulation of ubiquitin-protein transferase activity | 12628165 |
Hgene | FBXW7 | GO:1901800 | positive regulation of proteasomal protein catabolic process | 23858059 |
Hgene | FBXW7 | GO:1903378 | positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway | 23858059 |
Hgene | FBXW7 | GO:2000060 | positive regulation of ubiquitin-dependent protein catabolic process | 20208556 |
Tgene | ARFIP1 | GO:0006886 | intracellular protein transport | 12606037 |
Tgene | ARFIP1 | GO:0050708 | regulation of protein secretion | 12606037 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr4:153701378/chr4:153271276) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000281708 | FBXW7 | chr4 | 153268082 | - | ENST00000451320 | ARFIP1 | chr4 | 153831216 | + | 4250 | 1956 | 1002 | 2111 | 369 |
ENST00000603548 | FBXW7 | chr4 | 153268082 | - | ENST00000429148 | ARFIP1 | chr4 | 153831216 | + | 1917 | 906 | 81 | 1061 | 326 |
ENST00000296555 | FBXW7 | chr4 | 153268082 | - | ENST00000429148 | ARFIP1 | chr4 | 153831216 | + | 1563 | 552 | 180 | 707 | 175 |
ENST00000263981 | FBXW7 | chr4 | 153268082 | - | ENST00000429148 | ARFIP1 | chr4 | 153831216 | + | 1738 | 727 | 229 | 882 | 217 |
ENST00000393956 | FBXW7 | chr4 | 153268082 | - | ENST00000429148 | ARFIP1 | chr4 | 153831216 | + | 1286 | 275 | 71 | 430 | 119 |
ENST00000603841 | FBXW7 | chr4 | 153268082 | - | ENST00000429148 | ARFIP1 | chr4 | 153831216 | + | 1812 | 801 | 0 | 956 | 318 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000281708 | ENST00000451320 | FBXW7 | chr4 | 153268082 | - | ARFIP1 | chr4 | 153831216 | + | 0.000240156 | 0.99975985 |
ENST00000603548 | ENST00000429148 | FBXW7 | chr4 | 153268082 | - | ARFIP1 | chr4 | 153831216 | + | 0.000352483 | 0.9996475 |
ENST00000296555 | ENST00000429148 | FBXW7 | chr4 | 153268082 | - | ARFIP1 | chr4 | 153831216 | + | 0.021627951 | 0.97837204 |
ENST00000263981 | ENST00000429148 | FBXW7 | chr4 | 153268082 | - | ARFIP1 | chr4 | 153831216 | + | 0.030787995 | 0.96921194 |
ENST00000393956 | ENST00000429148 | FBXW7 | chr4 | 153268082 | - | ARFIP1 | chr4 | 153831216 | + | 0.12897725 | 0.8710227 |
ENST00000603841 | ENST00000429148 | FBXW7 | chr4 | 153268082 | - | ARFIP1 | chr4 | 153831216 | + | 0.000388017 | 0.99961203 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for FBXW7-ARFIP1 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
FBXW7 | chr4 | 153268082 | ARFIP1 | chr4 | 153831216 | 1956 | 317 | QPPTGLQEWLKMFQVKVLHNQLVLFH |
FBXW7 | chr4 | 153268082 | ARFIP1 | chr4 | 153831216 | 275 | 67 | QPPTGLQEWLKMFQVKVLHNQLVLFH |
FBXW7 | chr4 | 153268082 | ARFIP1 | chr4 | 153831216 | 552 | 123 | QPPTGLQEWLKMFQVKVLHNQLVLFH |
FBXW7 | chr4 | 153268082 | ARFIP1 | chr4 | 153831216 | 727 | 165 | QPPTGLQEWLKMFQVKVLHNQLVLFH |
FBXW7 | chr4 | 153268082 | ARFIP1 | chr4 | 153831216 | 801 | 266 | QPPTGLQEWLKMFQVKVLHNQLVLFH |
FBXW7 | chr4 | 153268082 | ARFIP1 | chr4 | 153831216 | 906 | 274 | QPPTGLQEWLKMFQVKVLHNQLVLFH |
Top |
Potential FusionNeoAntigen Information of FBXW7-ARFIP1 in HLA I |
![]() |
FBXW7-ARFIP1_153268082_153831216.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-B45:01 | QEWLKMFQV | 0.9984 | 0.9949 | 6 | 15 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-B50:02 | QEWLKMFQV | 0.9965 | 0.8497 | 6 | 15 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-B13:02 | QEWLKMFQV | 0.9907 | 0.9904 | 6 | 15 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-B14:02 | LKMFQVKVL | 0.9742 | 0.6277 | 9 | 18 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-B14:01 | LKMFQVKVL | 0.9742 | 0.6277 | 9 | 18 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-B44:05 | QEWLKMFQV | 0.944 | 0.8035 | 6 | 15 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-B41:02 | QEWLKMFQV | 0.8489 | 0.6894 | 6 | 15 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-B41:01 | QEWLKMFQV | 0.8199 | 0.9948 | 6 | 15 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-B47:01 | QEWLKMFQV | 0.7096 | 0.8674 | 6 | 15 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-B40:05 | QEWLKMFQV | 0.708 | 0.5722 | 6 | 15 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-B15:37 | LKMFQVKVL | 0.4246 | 0.5189 | 9 | 18 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-B48:01 | FQVKVLHNQL | 0.9174 | 0.6408 | 12 | 22 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-A02:27 | GLQEWLKMFQV | 0.9974 | 0.8559 | 4 | 15 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-A02:24 | GLQEWLKMFQV | 0.9973 | 0.8371 | 4 | 15 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-A02:30 | GLQEWLKMFQV | 0.9973 | 0.8371 | 4 | 15 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-A02:67 | GLQEWLKMFQV | 0.9973 | 0.8371 | 4 | 15 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-A02:60 | GLQEWLKMFQV | 0.9972 | 0.8509 | 4 | 15 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-A02:11 | GLQEWLKMFQV | 0.9972 | 0.8548 | 4 | 15 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-A02:16 | GLQEWLKMFQV | 0.997 | 0.7761 | 4 | 15 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-A02:04 | GLQEWLKMFQV | 0.9922 | 0.9657 | 4 | 15 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-A02:20 | GLQEWLKMFQV | 0.9394 | 0.8427 | 4 | 15 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-A02:29 | GLQEWLKMFQV | 0.9355 | 0.8415 | 4 | 15 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-A02:35 | GLQEWLKMFQV | 0.8905 | 0.8456 | 4 | 15 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-B15:04 | KMFQVKVL | 0.9951 | 0.7777 | 10 | 18 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-B40:06 | QEWLKMFQV | 0.9987 | 0.9871 | 6 | 15 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-B44:10 | QEWLKMFQV | 0.9717 | 0.9342 | 6 | 15 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-B40:03 | QEWLKMFQV | 0.8519 | 0.806 | 6 | 15 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-B15:04 | KMFQVKVLH | 0.453 | 0.7746 | 10 | 19 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-A02:01 | GLQEWLKMFQV | 0.9973 | 0.8371 | 4 | 15 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-B40:40 | QEWLKMFQV | 0.9935 | 0.5465 | 6 | 15 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-B40:04 | QEWLKMFQV | 0.9847 | 0.9635 | 6 | 15 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-B40:36 | QEWLKMFQV | 0.9528 | 0.8292 | 6 | 15 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-B41:03 | QEWLKMFQV | 0.7386 | 0.9688 | 6 | 15 |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 | HLA-B15:68 | LKMFQVKVL | 0.1861 | 0.5249 | 9 | 18 |
Top |
Potential FusionNeoAntigen Information of FBXW7-ARFIP1 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of FBXW7-ARFIP1 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
7254 | QEWLKMFQVKVLHN | FBXW7 | ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 727 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of FBXW7-ARFIP1 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 7254 | QEWLKMFQVKVLHN | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 7254 | QEWLKMFQVKVLHN | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 7254 | QEWLKMFQVKVLHN | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 7254 | QEWLKMFQVKVLHN | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 7254 | QEWLKMFQVKVLHN | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 7254 | QEWLKMFQVKVLHN | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 7254 | QEWLKMFQVKVLHN | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 7254 | QEWLKMFQVKVLHN | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 7254 | QEWLKMFQVKVLHN | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 7254 | QEWLKMFQVKVLHN | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 7254 | QEWLKMFQVKVLHN | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of FBXW7-ARFIP1 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 10 | 18 | KMFQVKVL | ATGTTTCAGGTTAAAGTATTGCAC |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 10 | 19 | KMFQVKVLH | ATGTTTCAGGTTAAAGTATTGCACAAT |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 12 | 22 | FQVKVLHNQL | CAGGTTAAAGTATTGCACAATCAGCTGGTC |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 4 | 15 | GLQEWLKMFQV | CTCCAGGAATGGCTAAAAATGTTTCAGGTTAAA |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 6 | 15 | QEWLKMFQV | GAATGGCTAAAAATGTTTCAGGTTAAA |
FBXW7-ARFIP1 | chr4 | 153268082 | chr4 | 153831216 | 9 | 18 | LKMFQVKVL | AAAATGTTTCAGGTTAAAGTATTGCAC |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of FBXW7-ARFIP1 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
Non-Cancer | FBXW7-ARFIP1 | chr4 | 153268082 | ENST00000263981 | chr4 | 153831216 | ENST00000429148 | ERR315398 |
Top |
Potential target of CAR-T therapy development for FBXW7-ARFIP1 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to FBXW7-ARFIP1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to FBXW7-ARFIP1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |