Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:FKBP8-MEF2B

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: FKBP8-MEF2B
	FusionPDB ID: 30530
	FusionGDB2.0 ID: 30530
		Hgene	Tgene
	Gene symbol	FKBP8	MEF2B
	Gene ID	23770	100271849
	Gene name	FKBP prolyl isomerase 8	myocyte enhancer factor 2B
	Synonyms	FKBP38\|FKBPr38	RSRFR2
	Cytomap	19p13.11	19p13.11
	Type of gene	protein-coding	protein-coding
	Description	peptidyl-prolyl cis-trans isomerase FKBP838 kDa FK506-binding protein38 kDa FKBPFK506 binding protein 8, 38kDaFK506-binding protein 8FKBP-38FKBP-8PPIase FKBP8hFKBP38rotamase	myocyte-specific enhancer factor 2BMADS box transcription enhancer factor 2, polypeptide B (myocyte enhancer factor 2B)serum response factor-like protein 2
	Modification date	20200327	20200313
	UniProtAcc	Q14318 Main function of 5'-partner protein: FUNCTION: Constitutively inactive PPiase, which becomes active when bound to calmodulin and calcium. Seems to act as a chaperone for BCL2, targets it to the mitochondria and modulates its phosphorylation state. The BCL2/FKBP8/calmodulin/calcium complex probably interferes with the binding of BCL2 to its targets. The active form of FKBP8 may therefore play a role in the regulation of apoptosis. {ECO:0000269\|PubMed:12510191, ECO:0000269\|PubMed:15757646, ECO:0000269\|PubMed:16176796}.	Q02080 Main function of 5'-partner protein: FUNCTION: Transcriptional activator which binds specifically to the MEF2 element, 5'-YTA[AT](4)TAR-3', found in numerous muscle-specific genes. Activates transcription via this element. May be involved in muscle-specific and/or growth factor-related transcription.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000222308, ENST00000453489, ENST00000608443, ENST00000596558, ENST00000597960, ENST00000610101,	ENST00000162023, ENST00000409224, ENST00000409447, ENST00000410050, ENST00000424583, ENST00000602424,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	12 X 15 X 5=900	5 X 4 X 5=100
	# samples	15	8
	** MAII score	log2(15/900*10)=-2.58496250072116 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(8/100*10)=-0.321928094887362 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: FKBP8 [Title/Abstract] AND MEF2B [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: FKBP8 [Title/Abstract] AND MEF2B [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	FKBP8(18649026)-MEF2B(19258641), # samples:2
Anticipated loss of major functional domain due to fusion event.	FKBP8-MEF2B seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FKBP8-MEF2B seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FKBP8-MEF2B seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. FKBP8-MEF2B seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. FKBP8-MEF2B seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. FKBP8-MEF2B seems lost the major protein functional domain in Tgene partner, which is a transcription factor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	MEF2B	GO:0045944	positive regulation of transcription by RNA polymerase II	7760790

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:18649026/chr19:19258641)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across FKBP8 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across MEF2B (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000597960	FKBP8	chr19	18649026	-	ENST00000409224	MEF2B	chr19	19258641	-	2221	893	1311	1	437
ENST00000597960	FKBP8	chr19	18649026	-	ENST00000424583	MEF2B	chr19	19258641	-	1970	893	1311	1	437
ENST00000597960	FKBP8	chr19	18649026	-	ENST00000410050	MEF2B	chr19	19258641	-	1991	893	1311	1	437
ENST00000597960	FKBP8	chr19	18649026	-	ENST00000602424	MEF2B	chr19	19258641	-	1857	893	731	1732	333
ENST00000597960	FKBP8	chr19	18649026	-	ENST00000409447	MEF2B	chr19	19258641	-	1700	893	1344	1	448
ENST00000597960	FKBP8	chr19	18649026	-	ENST00000162023	MEF2B	chr19	19258641	-	1786	893	1311	1	437
ENST00000596558	FKBP8	chr19	18649026	-	ENST00000409224	MEF2B	chr19	19258641	-	2207	879	1297	2	432
ENST00000596558	FKBP8	chr19	18649026	-	ENST00000424583	MEF2B	chr19	19258641	-	1956	879	1297	2	432
ENST00000596558	FKBP8	chr19	18649026	-	ENST00000410050	MEF2B	chr19	19258641	-	1977	879	1297	2	432
ENST00000596558	FKBP8	chr19	18649026	-	ENST00000602424	MEF2B	chr19	19258641	-	1843	879	717	1718	333
ENST00000596558	FKBP8	chr19	18649026	-	ENST00000409447	MEF2B	chr19	19258641	-	1686	879	1330	2	443
ENST00000596558	FKBP8	chr19	18649026	-	ENST00000162023	MEF2B	chr19	19258641	-	1772	879	1297	2	432
ENST00000597960	FKBP8	chr19	18649025	-	ENST00000409224	MEF2B	chr19	19258641	-	2221	893	1311	1	437
ENST00000597960	FKBP8	chr19	18649025	-	ENST00000424583	MEF2B	chr19	19258641	-	1970	893	1311	1	437
ENST00000597960	FKBP8	chr19	18649025	-	ENST00000410050	MEF2B	chr19	19258641	-	1991	893	1311	1	437
ENST00000597960	FKBP8	chr19	18649025	-	ENST00000602424	MEF2B	chr19	19258641	-	1857	893	731	1732	333
ENST00000597960	FKBP8	chr19	18649025	-	ENST00000409447	MEF2B	chr19	19258641	-	1700	893	1344	1	448
ENST00000597960	FKBP8	chr19	18649025	-	ENST00000162023	MEF2B	chr19	19258641	-	1786	893	1311	1	437
ENST00000596558	FKBP8	chr19	18649025	-	ENST00000409224	MEF2B	chr19	19258641	-	2207	879	1297	2	432
ENST00000596558	FKBP8	chr19	18649025	-	ENST00000424583	MEF2B	chr19	19258641	-	1956	879	1297	2	432
ENST00000596558	FKBP8	chr19	18649025	-	ENST00000410050	MEF2B	chr19	19258641	-	1977	879	1297	2	432
ENST00000596558	FKBP8	chr19	18649025	-	ENST00000602424	MEF2B	chr19	19258641	-	1843	879	717	1718	333
ENST00000596558	FKBP8	chr19	18649025	-	ENST00000409447	MEF2B	chr19	19258641	-	1686	879	1330	2	443
ENST00000596558	FKBP8	chr19	18649025	-	ENST00000162023	MEF2B	chr19	19258641	-	1772	879	1297	2	432

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000597960	ENST00000409224	FKBP8	chr19	18649026	-	MEF2B	chr19	19258641	-	0.006561184	0.9934388
ENST00000597960	ENST00000424583	FKBP8	chr19	18649026	-	MEF2B	chr19	19258641	-	0.006726785	0.99327314
ENST00000597960	ENST00000410050	FKBP8	chr19	18649026	-	MEF2B	chr19	19258641	-	0.006404389	0.99359566
ENST00000597960	ENST00000602424	FKBP8	chr19	18649026	-	MEF2B	chr19	19258641	-	0.005851278	0.99414873
ENST00000597960	ENST00000409447	FKBP8	chr19	18649026	-	MEF2B	chr19	19258641	-	0.005200497	0.9947995
ENST00000597960	ENST00000162023	FKBP8	chr19	18649026	-	MEF2B	chr19	19258641	-	0.006286219	0.9937138
ENST00000596558	ENST00000409224	FKBP8	chr19	18649026	-	MEF2B	chr19	19258641	-	0.008505293	0.99149466
ENST00000596558	ENST00000424583	FKBP8	chr19	18649026	-	MEF2B	chr19	19258641	-	0.0086663	0.99133366
ENST00000596558	ENST00000410050	FKBP8	chr19	18649026	-	MEF2B	chr19	19258641	-	0.008610637	0.99138933
ENST00000596558	ENST00000602424	FKBP8	chr19	18649026	-	MEF2B	chr19	19258641	-	0.00759079	0.9924092
ENST00000596558	ENST00000409447	FKBP8	chr19	18649026	-	MEF2B	chr19	19258641	-	0.006629442	0.99337053
ENST00000596558	ENST00000162023	FKBP8	chr19	18649026	-	MEF2B	chr19	19258641	-	0.008128826	0.99187124
ENST00000597960	ENST00000409224	FKBP8	chr19	18649025	-	MEF2B	chr19	19258641	-	0.006561184	0.9934388
ENST00000597960	ENST00000424583	FKBP8	chr19	18649025	-	MEF2B	chr19	19258641	-	0.006726785	0.99327314
ENST00000597960	ENST00000410050	FKBP8	chr19	18649025	-	MEF2B	chr19	19258641	-	0.006404389	0.99359566
ENST00000597960	ENST00000602424	FKBP8	chr19	18649025	-	MEF2B	chr19	19258641	-	0.005851278	0.99414873
ENST00000597960	ENST00000409447	FKBP8	chr19	18649025	-	MEF2B	chr19	19258641	-	0.005200497	0.9947995
ENST00000597960	ENST00000162023	FKBP8	chr19	18649025	-	MEF2B	chr19	19258641	-	0.006286219	0.9937138
ENST00000596558	ENST00000409224	FKBP8	chr19	18649025	-	MEF2B	chr19	19258641	-	0.008505293	0.99149466
ENST00000596558	ENST00000424583	FKBP8	chr19	18649025	-	MEF2B	chr19	19258641	-	0.0086663	0.99133366
ENST00000596558	ENST00000410050	FKBP8	chr19	18649025	-	MEF2B	chr19	19258641	-	0.008610637	0.99138933
ENST00000596558	ENST00000602424	FKBP8	chr19	18649025	-	MEF2B	chr19	19258641	-	0.00759079	0.9924092
ENST00000596558	ENST00000409447	FKBP8	chr19	18649025	-	MEF2B	chr19	19258641	-	0.006629442	0.99337053
ENST00000596558	ENST00000162023	FKBP8	chr19	18649025	-	MEF2B	chr19	19258641	-	0.008128826	0.99187124

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for FKBP8-MEF2B

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
FKBP8	chr19	18649025	MEF2B	chr19	19258641	879	52	TPTTSPSRLSPPAPKTLKRRGIGLDG
FKBP8	chr19	18649025	MEF2B	chr19	19258641	893	52	TPTTSPSRLSPPAPKTLKRRGIGLDG
FKBP8	chr19	18649026	MEF2B	chr19	19258641	879	52	TPTTSPSRLSPPAPKTLKRRGIGLDG
FKBP8	chr19	18649026	MEF2B	chr19	19258641	893	52	TPTTSPSRLSPPAPKTLKRRGIGLDG

Top

Potential FusionNeoAntigen Information of FKBP8-MEF2B in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

FKBP8-MEF2B_18649025_19258641.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B27:05	SRLSPPAPK	0.9994	0.8767	6	15
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B27:04	SRLSPPAPK	0.9984	0.7621	6	15
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B15:16	LSPPAPKTL	0.8851	0.5316	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B52:01	LSPPAPKTL	0.7743	0.7937	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B58:02	LSPPAPKTL	0.7143	0.898	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-A02:22	RLSPPAPKTL	0.9762	0.5803	7	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-A02:13	RLSPPAPKTL	0.9706	0.7684	7	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-A02:38	RLSPPAPKTL	0.9538	0.7534	7	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-A02:27	RLSPPAPKTL	0.9344	0.6704	7	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-A02:04	RLSPPAPKTL	0.9182	0.6106	7	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-A02:11	RLSPPAPKTL	0.9096	0.7204	7	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-A02:67	RLSPPAPKTL	0.9074	0.7141	7	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-A02:24	RLSPPAPKTL	0.9074	0.7141	7	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-A02:30	RLSPPAPKTL	0.9074	0.7141	7	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-A02:16	RLSPPAPKTL	0.8937	0.6077	7	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-A02:35	RLSPPAPKTL	0.8093	0.7254	7	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-A02:29	RLSPPAPKTL	0.786	0.7083	7	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B48:01	RLSPPAPKTL	0.7723	0.6069	7	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-A02:20	RLSPPAPKTL	0.7498	0.7208	7	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B13:02	RLSPPAPKTL	0.3071	0.6134	7	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B13:01	RLSPPAPKTL	0.1864	0.9481	7	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B27:04	SRLSPPAPKTL	1	0.8353	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B27:02	SRLSPPAPKTL	1	0.6895	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B27:05	SRLSPPAPKTL	1	0.8739	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B39:24	SRLSPPAPKTL	0.9998	0.6633	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-A30:08	RLSPPAPKTLK	0.9993	0.7388	7	18
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B27:05	SPSRLSPPAPK	0.9879	0.7919	4	15
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B07:10	SRLSPPAPKTL	0.9267	0.5157	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B73:01	SRLSPPAP	0.9924	0.705	6	14
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C01:30	SPPAPKTL	0.9749	0.9471	9	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C01:17	SPPAPKTL	0.9688	0.941	9	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B39:10	SPPAPKTL	0.7204	0.9282	9	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C03:07	LSPPAPKTL	0.9987	0.9575	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C03:08	LSPPAPKTL	0.9981	0.9192	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C03:19	LSPPAPKTL	0.998	0.9833	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B27:14	SRLSPPAPK	0.9979	0.8416	6	15
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C15:06	LSPPAPKTL	0.9954	0.9124	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C12:12	LSPPAPKTL	0.9948	0.9313	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C06:03	LSPPAPKTL	0.9921	0.9933	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C12:04	LSPPAPKTL	0.9913	0.9917	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C04:06	LSPPAPKTL	0.9852	0.8578	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B27:03	SRLSPPAPK	0.9843	0.8986	6	15
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C01:17	LSPPAPKTL	0.962	0.9249	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C01:30	LSPPAPKTL	0.9499	0.9438	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C04:14	LSPPAPKTL	0.9259	0.7785	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C08:04	LSPPAPKTL	0.9121	0.96	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C08:13	LSPPAPKTL	0.9121	0.96	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C08:15	LSPPAPKTL	0.8512	0.9416	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C07:19	LSPPAPKTL	0.5642	0.7067	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C07:29	LSPPAPKTL	0.5318	0.9419	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C07:13	LSPPAPKTL	0.5305	0.8645	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C02:06	LSPPAPKTL	0.4987	0.9556	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C08:03	LSPPAPKTL	0.4842	0.9758	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C01:17	RLSPPAPKTL	0.968	0.9456	7	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C01:30	RLSPPAPKTL	0.958	0.9519	7	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-A02:07	RLSPPAPKTL	0.9123	0.7375	7	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-A02:01	RLSPPAPKTL	0.9074	0.7141	7	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B27:14	SRLSPPAPKTL	1	0.8803	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C07:05	SRLSPPAPKTL	0.9999	0.9768	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C07:95	SRLSPPAPKTL	0.9999	0.7883	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C07:27	SRLSPPAPKTL	0.9998	0.9748	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C07:80	SRLSPPAPKTL	0.9998	0.9723	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C07:67	SRLSPPAPKTL	0.9998	0.9723	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C07:46	SRLSPPAPKTL	0.9998	0.9433	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C07:19	SRLSPPAPKTL	0.9997	0.8509	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C07:29	SRLSPPAPKTL	0.9997	0.9695	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C07:13	SRLSPPAPKTL	0.9996	0.9639	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C07:10	SRLSPPAPKTL	0.9995	0.9703	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B39:12	SRLSPPAPKTL	0.9994	0.9569	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B27:03	SRLSPPAPKTL	0.9991	0.8928	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C01:30	SRLSPPAPKTL	0.999	0.9514	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C01:17	SRLSPPAPKTL	0.9989	0.9506	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B27:14	SPSRLSPPAPK	0.9794	0.7772	4	15
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C01:02	SPPAPKTL	0.9482	0.9371	9	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C01:03	SPPAPKTL	0.8217	0.8688	9	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B67:01	SPPAPKTL	0.783	0.7774	9	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B27:08	SRLSPPAPK	0.9993	0.7903	6	15
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B27:10	SRLSPPAPK	0.9992	0.8618	6	15
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C03:03	LSPPAPKTL	0.9986	0.9849	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C03:04	LSPPAPKTL	0.9986	0.9849	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C03:05	LSPPAPKTL	0.9981	0.9016	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C03:17	LSPPAPKTL	0.9979	0.957	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C03:67	LSPPAPKTL	0.9967	0.9758	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C12:03	LSPPAPKTL	0.9955	0.9769	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C15:05	LSPPAPKTL	0.9946	0.8849	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C15:02	LSPPAPKTL	0.9901	0.8709	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C03:02	LSPPAPKTL	0.9898	0.9656	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C06:06	LSPPAPKTL	0.9885	0.9885	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C16:04	LSPPAPKTL	0.9868	0.979	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C06:17	LSPPAPKTL	0.9831	0.9911	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C06:02	LSPPAPKTL	0.9831	0.9911	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C12:02	LSPPAPKTL	0.983	0.9649	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C04:04	LSPPAPKTL	0.9781	0.8553	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C18:01	LSPPAPKTL	0.9735	0.7195	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C03:06	LSPPAPKTL	0.9694	0.984	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C04:03	LSPPAPKTL	0.9626	0.7598	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C01:02	LSPPAPKTL	0.9585	0.9204	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C01:03	LSPPAPKTL	0.9508	0.8549	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C16:01	LSPPAPKTL	0.8691	0.9805	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C08:02	LSPPAPKTL	0.8512	0.9416	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B58:06	LSPPAPKTL	0.8491	0.7399	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C16:02	LSPPAPKTL	0.7767	0.9916	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C07:22	LSPPAPKTL	0.7561	0.7318	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C07:04	LSPPAPKTL	0.7539	0.8461	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B57:02	LSPPAPKTL	0.7353	0.8153	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C08:01	LSPPAPKTL	0.4842	0.9758	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C06:08	LSPPAPKTL	0.4785	0.9897	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C02:02	LSPPAPKTL	0.4661	0.9772	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C02:10	LSPPAPKTL	0.4661	0.9772	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B07:13	LSPPAPKTL	0.1812	0.7711	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C17:01	LSPPAPKTL	0.1554	0.7612	8	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-A32:01	RLSPPAPKTL	0.9887	0.9656	7	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-A02:03	RLSPPAPKTL	0.986	0.7391	7	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C01:03	RLSPPAPKTL	0.9816	0.9466	7	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B15:73	RLSPPAPKTL	0.9811	0.9508	7	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C01:02	RLSPPAPKTL	0.9765	0.9428	7	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B15:30	RLSPPAPKTL	0.9433	0.9497	7	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B40:21	RLSPPAPKTL	0.2368	0.6188	7	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B27:10	SRLSPPAPKTL	1	0.9075	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B27:08	SRLSPPAPKTL	1	0.8377	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B27:09	SRLSPPAPKTL	1	0.8388	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B27:06	SRLSPPAPKTL	1	0.8356	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C07:01	SRLSPPAPKTL	0.9999	0.7936	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C07:02	SRLSPPAPKTL	0.9998	0.9723	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C06:08	SRLSPPAPKTL	0.9998	0.9906	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C07:22	SRLSPPAPKTL	0.9997	0.8104	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B39:31	SRLSPPAPKTL	0.9995	0.9533	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C01:02	SRLSPPAPKTL	0.9995	0.9498	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C01:03	SRLSPPAPKTL	0.9994	0.9299	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-A30:01	RLSPPAPKTLK	0.9993	0.8645	7	18
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C06:02	SRLSPPAPKTL	0.9986	0.9931	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-C06:17	SRLSPPAPKTL	0.9986	0.9931	6	17
FKBP8-MEF2B	chr19	18649025	chr19	19258641	879	HLA-B27:10	SPSRLSPPAPK	0.9862	0.8224	4	15

Top

Potential FusionNeoAntigen Information of FKBP8-MEF2B in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of FKBP8-MEF2B

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
8969	SRLSPPAPKTLKRR	FKBP8	MEF2B	chr19	18649025	chr19	19258641	879

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of FKBP8-MEF2B

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	8969	SRLSPPAPKTLKRR	-6.18902	-6.30242
HLA-B14:02	3BVN	8969	SRLSPPAPKTLKRR	-5.51674	-6.55204
HLA-B52:01	3W39	8969	SRLSPPAPKTLKRR	-6.26372	-6.37712
HLA-B52:01	3W39	8969	SRLSPPAPKTLKRR	-2.88933	-3.92463
HLA-A11:01	4UQ2	8969	SRLSPPAPKTLKRR	-8.95966	-9.99496
HLA-A24:02	5HGA	8969	SRLSPPAPKTLKRR	-7.97421	-8.08761
HLA-A24:02	5HGA	8969	SRLSPPAPKTLKRR	-4.46014	-5.49544
HLA-B44:05	3DX8	8969	SRLSPPAPKTLKRR	-4.21738	-4.33078
HLA-B44:05	3DX8	8969	SRLSPPAPKTLKRR	-3.79801	-4.83331
HLA-A02:01	6TDR	8969	SRLSPPAPKTLKRR	-6.07498	-7.11028

Top

Vaccine Design for the FusionNeoAntigens of FKBP8-MEF2B

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
FKBP8-MEF2B	chr19	18649025	chr19	19258641	4	15	SPSRLSPPAPK	TCAAGGCTATCACCTCCAGCGCCAAAGACGCTG
FKBP8-MEF2B	chr19	18649025	chr19	19258641	6	14	SRLSPPAP	CTATCACCTCCAGCGCCAAAGACG
FKBP8-MEF2B	chr19	18649025	chr19	19258641	6	15	SRLSPPAPK	CTATCACCTCCAGCGCCAAAGACGCTG
FKBP8-MEF2B	chr19	18649025	chr19	19258641	6	17	SRLSPPAPKTL	CTATCACCTCCAGCGCCAAAGACGCTGAAGCGG
FKBP8-MEF2B	chr19	18649025	chr19	19258641	7	17	RLSPPAPKTL	TCACCTCCAGCGCCAAAGACGCTGAAGCGG
FKBP8-MEF2B	chr19	18649025	chr19	19258641	7	18	RLSPPAPKTLK	TCACCTCCAGCGCCAAAGACGCTGAAGCGGAGG
FKBP8-MEF2B	chr19	18649025	chr19	19258641	8	17	LSPPAPKTL	CCTCCAGCGCCAAAGACGCTGAAGCGG
FKBP8-MEF2B	chr19	18649025	chr19	19258641	9	17	SPPAPKTL	CCAGCGCCAAAGACGCTGAAGCGG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of FKBP8-MEF2B

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
OV	FKBP8-MEF2B	chr19	18649025	ENST00000596558	chr19	19258641	ENST00000602424	TCGA-61-2000

Top

Potential target of CAR-T therapy development for FKBP8-MEF2B

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to FKBP8-MEF2B

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to FKBP8-MEF2B

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)