|
|||||||
|
Fusion Protein:AHCYL1-ZFYVE9 |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: AHCYL1-ZFYVE9 | FusionPDB ID: 3058 | FusionGDB2.0 ID: 3058 | Hgene | Tgene | Gene symbol | AHCYL1 | ZFYVE9 | Gene ID | 10768 | 9372 |
| Gene name | adenosylhomocysteinase like 1 | zinc finger FYVE-type containing 9 | |
| Synonyms | DCAL|IRBIT|PPP1R78|PRO0233|XPVKONA | MADHIP|NSP|PPP1R173|SARA|SMADIP | |
| Cytomap | 1p13.3 | 1p32.3 | |
| Type of gene | protein-coding | protein-coding | |
| Description | S-adenosylhomocysteine hydrolase-like protein 1DC-expressed AHCY-like moleculeIP(3)Rs binding protein released with IP(3)S-adenosyl homocysteine hydrolase homologS-adenosyl-L-homocysteine hydrolase 2adenosylhomocysteinase 2adoHcyase 2dendritic cell | zinc finger FYVE domain-containing protein 9MAD, mothers against decapentaplegic homolog interacting protein, receptor activation anchorMADH-interacting proteinnovel serine proteaseprotein phosphatase 1, regulatory subunit 173smad anchor for receptor | |
| Modification date | 20200313 | 20200313 | |
| UniProtAcc | O43865 Main function of 5'-partner protein: FUNCTION: Multifaceted cellular regulator which coordinates several essential cellular functions including regulation of epithelial HCO3(-) and fluid secretion, mRNA processing and DNA replication. Regulates ITPR1 sensitivity to inositol 1,4,5-trisphosphate, competing for the common binding site and acting as endogenous 'pseudoligand' whose inhibitory activity can be modulated by its phosphorylation status. Promotes the formation of contact points between the endoplasmic reticulum (ER) and mitochondria, facilitating transfer of Ca(2+) from the ER to mitochondria (PubMed:27995898). Under normal cellular conditions, functions cooperatively with BCL2L10 to limit ITPR1-mediated Ca(2+) release but, under apoptotic stress conditions, dephosphorylated which promotes dissociation of both AHCYL1 and BCL2L10 from mitochondria-associated endoplasmic reticulum membranes, inhibits BCL2L10 interaction with ITPR1 and leads to increased Ca(2+) transfer to mitochondria which promotes apoptosis (PubMed:27995898). In the pancreatic and salivary ducts, at resting state, attenuates inositol 1,4,5-trisphosphate-induced calcium release by interacting with ITPR1 (PubMed:16793548). When extracellular stimuli induce ITPR1 phosphorylation or inositol 1,4,5-trisphosphate production, dissociates from ITPR1 to interact with CFTR and SLC26A6, mediating their synergistic activation by calcium and cAMP that stimulates the epithelial secretion of electrolytes and fluid (By similarity). Also activates basolateral SLC4A4 isoform 1 to coordinate fluid and HCO3(-) secretion (PubMed:16769890). Inhibits the effect of STK39 on SLC4A4 and CFTR by recruiting PP1 phosphatase which activates SLC4A4, SLC26A6 and CFTR through dephosphorylation (By similarity). Mediates the induction of SLC9A3 surface expression produced by Angiotensin-2 (PubMed:20584908). Depending on the cell type, activates SLC9A3 in response to calcium or reverses SLC9A3R2-dependent calcium inhibition (PubMed:18829453). May modulate the polyadenylation state of specific mRNAs, both by controlling the subcellular location of FIP1L1 and by inhibiting PAPOLA activity, in response to a stimulus that alters its phosphorylation state (PubMed:19224921). Acts as a (dATP)-dependent inhibitor of ribonucleotide reductase large subunit RRM1, controlling the endogenous dNTP pool and ensuring normal cell cycle progression (PubMed:25237103). In vitro does not exhibit any S-adenosyl-L-homocysteine hydrolase activity (By similarity). {ECO:0000250|UniProtKB:B5DFN2, ECO:0000250|UniProtKB:Q80SW1, ECO:0000269|PubMed:16769890, ECO:0000269|PubMed:16793548, ECO:0000269|PubMed:18829453, ECO:0000269|PubMed:19224921, ECO:0000269|PubMed:20584908, ECO:0000269|PubMed:25237103, ECO:0000269|PubMed:27995898}. | . | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000475081, ENST00000369799, ENST00000359172, ENST00000393614, | ENST00000287727, ENST00000357206, ENST00000371591, ENST00000469134, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 12 X 9 X 4=432 | 7 X 6 X 4=168 |
| # samples | 14 | 7 | |
| ** MAII score | log2(14/432*10)=-1.6256044852185 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(7/168*10)=-1.26303440583379 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: AHCYL1 [Title/Abstract] AND ZFYVE9 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: AHCYL1 [Title/Abstract] AND ZFYVE9 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | AHCYL1(110527794)-ZFYVE9(52798440), # samples:1 | ||
| Anticipated loss of major functional domain due to fusion event. | AHCYL1-ZFYVE9 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. AHCYL1-ZFYVE9 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | AHCYL1 | GO:0006378 | mRNA polyadenylation | 19224921 |
| Hgene | AHCYL1 | GO:0031440 | regulation of mRNA 3'-end processing | 19224921 |
| Hgene | AHCYL1 | GO:0038166 | angiotensin-activated signaling pathway | 20584908 |
| Hgene | AHCYL1 | GO:0051592 | response to calcium ion | 18829453 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:110527794/chr1:52798440) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across AHCYL1 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across ZFYVE9 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000369799 | AHCYL1 | chr1 | 110527794 | + | ENST00000357206 | ZFYVE9 | chr1 | 52798440 | + | 1621 | 487 | 40 | 1326 | 428 |
| ENST00000369799 | AHCYL1 | chr1 | 110527794 | + | ENST00000287727 | ZFYVE9 | chr1 | 52798440 | + | 1791 | 487 | 40 | 1326 | 428 |
| ENST00000369799 | AHCYL1 | chr1 | 110527794 | + | ENST00000371591 | ZFYVE9 | chr1 | 52798440 | + | 1792 | 487 | 40 | 1326 | 428 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000369799 | ENST00000357206 | AHCYL1 | chr1 | 110527794 | + | ZFYVE9 | chr1 | 52798440 | + | 0.001419444 | 0.9985806 |
| ENST00000369799 | ENST00000287727 | AHCYL1 | chr1 | 110527794 | + | ZFYVE9 | chr1 | 52798440 | + | 0.001690497 | 0.9983095 |
| ENST00000369799 | ENST00000371591 | AHCYL1 | chr1 | 110527794 | + | ZFYVE9 | chr1 | 52798440 | + | 0.00167519 | 0.9983248 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for AHCYL1-ZFYVE9 |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| AHCYL1 | chr1 | 110527794 | ZFYVE9 | chr1 | 52798440 | 487 | 149 | YSFMATVTKAPKKMMKAMNKSNEHVL |
Top |
Potential FusionNeoAntigen Information of AHCYL1-ZFYVE9 in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| AHCYL1-ZFYVE9_110527794_52798440.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | HLA-B08:09 | APKKMMKA | 0.989 | 0.6224 | 9 | 17 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | HLA-B08:09 | APKKMMKAM | 0.9096 | 0.5626 | 9 | 18 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | HLA-A30:08 | VTKAPKKMMK | 0.9935 | 0.5701 | 6 | 16 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | HLA-B39:10 | APKKMMKAM | 0.0908 | 0.8375 | 9 | 18 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | HLA-A30:01 | KKMMKAMNK | 0.8046 | 0.8544 | 11 | 20 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | HLA-B08:12 | APKKMMKAM | 0.5876 | 0.6308 | 9 | 18 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | HLA-B35:11 | APKKMMKAM | 0.3579 | 0.8756 | 9 | 18 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | HLA-B35:30 | APKKMMKAM | 0.3126 | 0.5564 | 9 | 18 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | HLA-B35:17 | APKKMMKAM | 0.3126 | 0.5564 | 9 | 18 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | HLA-B67:01 | APKKMMKAM | 0.1556 | 0.7323 | 9 | 18 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | HLA-B35:43 | APKKMMKAM | 0.0126 | 0.7251 | 9 | 18 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | HLA-B15:08 | APKKMMKAM | 0.0112 | 0.7276 | 9 | 18 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | HLA-B15:11 | APKKMMKAM | 0.0108 | 0.7206 | 9 | 18 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | HLA-A30:01 | VTKAPKKMMK | 0.9929 | 0.7249 | 6 | 16 |
Top |
Potential FusionNeoAntigen Information of AHCYL1-ZFYVE9 in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| AHCYL1-ZFYVE9_110527794_52798440.msa |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-0801 | PKKMMKAMNKSNEHV | 10 | 25 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-0805 | PKKMMKAMNKSNEHV | 10 | 25 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-0805 | KKMMKAMNKSNEHVL | 11 | 26 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-0806 | PKKMMKAMNKSNEHV | 10 | 25 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-0806 | KKMMKAMNKSNEHVL | 11 | 26 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-0816 | PKKMMKAMNKSNEHV | 10 | 25 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-0822 | PKKMMKAMNKSNEHV | 10 | 25 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-0822 | KKMMKAMNKSNEHVL | 11 | 26 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-0822 | APKKMMKAMNKSNEH | 9 | 24 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-0826 | PKKMMKAMNKSNEHV | 10 | 25 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-0839 | PKKMMKAMNKSNEHV | 10 | 25 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-0840 | PKKMMKAMNKSNEHV | 10 | 25 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-1303 | PKKMMKAMNKSNEHV | 10 | 25 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-1312 | PKKMMKAMNKSNEHV | 10 | 25 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-1321 | PKKMMKAMNKSNEHV | 10 | 25 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-1349 | PKKMMKAMNKSNEHV | 10 | 25 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-1355 | PKKMMKAMNKSNEHV | 10 | 25 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-1358 | PKKMMKAMNKSNEHV | 10 | 25 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-1358 | KKMMKAMNKSNEHVL | 11 | 26 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-1358 | APKKMMKAMNKSNEH | 9 | 24 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-1381 | PKKMMKAMNKSNEHV | 10 | 25 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-1381 | KKMMKAMNKSNEHVL | 11 | 26 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-1381 | APKKMMKAMNKSNEH | 9 | 24 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-1388 | PKKMMKAMNKSNEHV | 10 | 25 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-1389 | PKKMMKAMNKSNEHV | 10 | 25 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-1389 | KKMMKAMNKSNEHVL | 11 | 26 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-1389 | APKKMMKAMNKSNEH | 9 | 24 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-1390 | PKKMMKAMNKSNEHV | 10 | 25 |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 | DRB1-1395 | PKKMMKAMNKSNEHV | 10 | 25 |
Top |
Fusion breakpoint peptide structures of AHCYL1-ZFYVE9 |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 10309 | VTKAPKKMMKAMNK | AHCYL1 | ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 487 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of AHCYL1-ZFYVE9 |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 10309 | VTKAPKKMMKAMNK | -8.55667 | -8.74867 |
| HLA-B14:02 | 3BVN | 10309 | VTKAPKKMMKAMNK | -3.49457 | -4.25557 |
| HLA-B52:01 | 3W39 | 10309 | VTKAPKKMMKAMNK | -7.26725 | -7.45925 |
| HLA-B52:01 | 3W39 | 10309 | VTKAPKKMMKAMNK | -4.01461 | -4.77561 |
| HLA-A24:02 | 5HGA | 10309 | VTKAPKKMMKAMNK | -7.65911 | -8.42011 |
| HLA-A24:02 | 5HGA | 10309 | VTKAPKKMMKAMNK | -7.10204 | -7.29404 |
| HLA-B44:05 | 3DX8 | 10309 | VTKAPKKMMKAMNK | -7.5556 | -8.3166 |
| HLA-B44:05 | 3DX8 | 10309 | VTKAPKKMMKAMNK | -2.76159 | -2.95359 |
| HLA-B35:01 | 1A1N | 10309 | VTKAPKKMMKAMNK | -5.4014 | -6.1624 |
| HLA-B35:01 | 1A1N | 10309 | VTKAPKKMMKAMNK | -4.87859 | -5.07059 |
Top |
Vaccine Design for the FusionNeoAntigens of AHCYL1-ZFYVE9 |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 11 | 20 | KKMMKAMNK | AAGAAGATGATGAAAGCCATGAACAAG |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 6 | 16 | VTKAPKKMMK | GTCACCAAGGCGCCCAAGAAGATGATGAAA |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 9 | 17 | APKKMMKA | GCGCCCAAGAAGATGATGAAAGCC |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 9 | 18 | APKKMMKAM | GCGCCCAAGAAGATGATGAAAGCCATG |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 10 | 25 | PKKMMKAMNKSNEHV | CCCAAGAAGATGATGAAAGCCATGAACAAGTCCAATGAGCATGTC |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 11 | 26 | KKMMKAMNKSNEHVL | AAGAAGATGATGAAAGCCATGAACAAGTCCAATGAGCATGTCCTG |
| AHCYL1-ZFYVE9 | chr1 | 110527794 | chr1 | 52798440 | 9 | 24 | APKKMMKAMNKSNEH | GCGCCCAAGAAGATGATGAAAGCCATGAACAAGTCCAATGAGCAT |
Top |
Information of the samples that have these potential fusion neoantigens of AHCYL1-ZFYVE9 |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| STAD | AHCYL1-ZFYVE9 | chr1 | 110527794 | ENST00000369799 | chr1 | 52798440 | ENST00000287727 | TCGA-HU-A4GH-01A |
Top |
Potential target of CAR-T therapy development for AHCYL1-ZFYVE9 |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to AHCYL1-ZFYVE9 |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to AHCYL1-ZFYVE9 |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies