Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:FOXO3-GMDS

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: FOXO3-GMDS
	FusionPDB ID: 31176
	FusionGDB2.0 ID: 31176
		Hgene	Tgene
	Gene symbol	FOXO3	GMDS
	Gene ID	2309	2762
	Gene name	forkhead box O3	GDP-mannose 4,6-dehydratase
	Synonyms	AF6q21\|FKHRL1\|FKHRL1P2\|FOXO2\|FOXO3A	GMD\|SDR3E1
	Cytomap	6q21	6p25.3
	Type of gene	protein-coding	protein-coding
	Description	forkhead box protein O3forkhead box O3Aforkhead homolog (rhabdomyosarcoma) like 1forkhead in rhabdomyosarcoma-like 1forkhead, Drosophila, homolog of, in rhabdomyosarcoma-like 1	GDP-mannose 4,6 dehydrataseGDP-D-mannose dehydrataseshort chain dehydrogenase/reductase family 3E, member 1
	Modification date	20200329	20200313
	UniProtAcc	O43524 Main function of 5'-partner protein: FUNCTION: Transcriptional activator that recognizes and binds to the DNA sequence 5'-[AG]TAAA[TC]A-3' and regulates different processes, such as apoptosis and autophagy (PubMed:10102273, PubMed:16751106, PubMed:21329882). Acts as a positive regulator of autophagy in skeletal muscle: in starved cells, enters the nucleus following dephosphorylation and binds the promoters of autophagy genes, such as GABARAP1L, MAP1LC3B and ATG12, thereby activating their expression, resulting in proteolysis of skeletal muscle proteins (By similarity). Triggers apoptosis in the absence of survival factors, including neuronal cell death upon oxidative stress (PubMed:10102273, PubMed:16751106). Participates in post-transcriptional regulation of MYC: following phosphorylation by MAPKAPK5, promotes induction of miR-34b and miR-34c expression, 2 post-transcriptional regulators of MYC that bind to the 3'UTR of MYC transcript and prevent its translation (PubMed:21329882). In response to metabolic stress, translocates into the mitochondria where it promotes mtDNA transcription (PubMed:23283301). In response to metabolic stress, translocates into the mitochondria where it promotes mtDNA transcription. Also acts as a key regulator of chondrogenic commitment of skeletal progenitor cells in response to lipid availability: when lipids levels are low, translocates to the nucleus and promotes expression of SOX9, which induces chondrogenic commitment and suppresses fatty acid oxidation (By similarity). {ECO:0000250\|UniProtKB:Q9WVH4, ECO:0000269\|PubMed:10102273, ECO:0000269\|PubMed:16751106, ECO:0000269\|PubMed:21329882, ECO:0000269\|PubMed:23283301}.	O60547 Main function of 5'-partner protein: FUNCTION: Catalyzes the conversion of GDP-D-mannose to GDP-4-dehydro-6-deoxy-D-mannose. {ECO:0000269\|PubMed:9525924}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000343882, ENST00000406360, ENST00000540898,	ENST00000467288, ENST00000380815, ENST00000530927,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	9 X 5 X 7=315	14 X 10 X 8=1120
	# samples	12	15
	** MAII score	log2(12/315*10)=-1.39231742277876 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(15/1120*10)=-2.90046432644909 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: FOXO3 [Title/Abstract] AND GMDS [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: FOXO3 [Title/Abstract] AND GMDS [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	FOXO3(108883032)-GMDS(1961200), # samples:2
Anticipated loss of major functional domain due to fusion event.	FOXO3-GMDS seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FOXO3-GMDS seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	FOXO3	GO:0000122	negative regulation of transcription by RNA polymerase II	20371612
Hgene	FOXO3	GO:0006417	regulation of translation	21329882
Hgene	FOXO3	GO:0043065	positive regulation of apoptotic process	20371612
Hgene	FOXO3	GO:0045648	positive regulation of erythrocyte differentiation	14734530
Hgene	FOXO3	GO:0045893	positive regulation of transcription, DNA-templated	10102273\|15084260
Hgene	FOXO3	GO:0045944	positive regulation of transcription by RNA polymerase II	10102273\|14734530
Tgene	GMDS	GO:0019673	GDP-mannose metabolic process	9525924
Tgene	GMDS	GO:0042351	'de novo' GDP-L-fucose biosynthetic process	9525924

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr6:108883032/chr6:1961200)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across FOXO3 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across GMDS (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000343882	FOXO3	chr6	108883032	+	ENST00000530927	GMDS	chr6	1961200	-	2062	925	238	1698	486
ENST00000343882	FOXO3	chr6	108883032	+	ENST00000380815	GMDS	chr6	1961200	-	2062	925	238	1698	486
ENST00000406360	FOXO3	chr6	108883032	+	ENST00000530927	GMDS	chr6	1961200	-	2101	964	205	1737	510
ENST00000406360	FOXO3	chr6	108883032	+	ENST00000380815	GMDS	chr6	1961200	-	2101	964	205	1737	510

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000343882	ENST00000530927	FOXO3	chr6	108883032	+	GMDS	chr6	1961200	-	0.005954035	0.994046
ENST00000343882	ENST00000380815	FOXO3	chr6	108883032	+	GMDS	chr6	1961200	-	0.005954035	0.994046
ENST00000406360	ENST00000530927	FOXO3	chr6	108883032	+	GMDS	chr6	1961200	-	0.005406715	0.9945933
ENST00000406360	ENST00000380815	FOXO3	chr6	108883032	+	GMDS	chr6	1961200	-	0.005406715	0.9945933

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for FOXO3-GMDS

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
FOXO3	chr6	108883032	GMDS	chr6	1961200	925	229	KDKGDSNSSAGWKISFDLAEYTADVD
FOXO3	chr6	108883032	GMDS	chr6	1961200	964	253	KDKGDSNSSAGWKISFDLAEYTADVD

Top

Potential FusionNeoAntigen Information of FOXO3-GMDS in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

FOXO3-GMDS_108883032_1961200.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-B15:01	KISFDLAEY	0.9981	0.9338	12	21
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-B15:25	KISFDLAEY	0.9977	0.9357	12	21
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-B15:17	SSAGWKISF	0.9972	0.929	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-B57:01	SSAGWKISF	0.9966	0.9764	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-B15:16	SSAGWKISF	0.9956	0.661	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-B58:02	SSAGWKISF	0.9933	0.9627	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-B58:01	SSAGWKISF	0.9921	0.9562	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-B57:03	SSAGWKISF	0.9917	0.9615	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-A32:13	SSAGWKISF	0.8672	0.9624	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C03:08	SSAGWKISF	0.9976	0.9221	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C15:04	SSAGWKISF	0.9943	0.9387	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C03:19	SSAGWKISF	0.9936	0.9839	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-B15:07	KISFDLAEY	0.992	0.7695	12	21
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C15:06	SSAGWKISF	0.9832	0.9571	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C12:12	SSAGWKISF	0.976	0.9148	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C03:07	SSAGWKISF	0.976	0.9895	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C07:95	SSAGWKISF	0.9746	0.7085	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C03:14	SSAGWKISF	0.9714	0.9838	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-B15:05	KISFDLAEY	0.9657	0.9233	12	21
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C06:03	SSAGWKISF	0.882	0.9943	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C12:04	SSAGWKISF	0.8623	0.9962	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C02:06	SSAGWKISF	0.4239	0.9861	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C16:01	SAGWKISF	0.997	0.9798	8	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C03:02	SSAGWKISF	0.9986	0.9699	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-B57:04	SSAGWKISF	0.9984	0.8184	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-B15:34	KISFDLAEY	0.9981	0.9338	12	21
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-B15:125	KISFDLAEY	0.9981	0.9338	12	21
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-B15:33	KISFDLAEY	0.9981	0.9338	12	21
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-B15:27	KISFDLAEY	0.9981	0.9385	12	21
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-B15:135	KISFDLAEY	0.998	0.9379	12	21
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-B15:39	KISFDLAEY	0.9979	0.8685	12	21
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-B15:50	KISFDLAEY	0.9978	0.937	12	21
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C03:04	SSAGWKISF	0.9976	0.9905	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C03:03	SSAGWKISF	0.9976	0.9905	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-B57:10	SSAGWKISF	0.9966	0.9764	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-B58:06	SSAGWKISF	0.9966	0.8815	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C15:09	SSAGWKISF	0.9943	0.9387	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-B57:02	SSAGWKISF	0.994	0.967	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C16:04	SSAGWKISF	0.9936	0.9805	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-B15:35	KISFDLAEY	0.9931	0.931	12	21
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C03:05	SSAGWKISF	0.9917	0.9281	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C03:17	SSAGWKISF	0.9912	0.9782	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C12:02	SSAGWKISF	0.982	0.9734	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-A32:01	SSAGWKISF	0.978	0.9334	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C07:01	SSAGWKISF	0.9745	0.7132	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C12:03	SSAGWKISF	0.9737	0.983	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C15:05	SSAGWKISF	0.9699	0.9253	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-B15:20	KISFDLAEY	0.9675	0.9468	12	21
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-A25:01	SSAGWKISF	0.9503	0.823	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C15:02	SSAGWKISF	0.9496	0.9118	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C16:01	SSAGWKISF	0.9396	0.9812	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C16:02	SSAGWKISF	0.8121	0.9948	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C02:02	SSAGWKISF	0.5593	0.9862	7	16
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	HLA-C02:10	SSAGWKISF	0.5593	0.9862	7	16

Top

Potential FusionNeoAntigen Information of FOXO3-GMDS in HLA II

FOXO3-GMDS_108883032_1961200.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	DRB1-0417	SAGWKISFDLAEYTA	8	23
FOXO3-GMDS	chr6	108883032	chr6	1961200	925	DRB1-0417	SSAGWKISFDLAEYT	7	22

Top

Fusion breakpoint peptide structures of FOXO3-GMDS

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
6388	NSSAGWKISFDLAE	FOXO3	GMDS	chr6	108883032	chr6	1961200	925

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of FOXO3-GMDS

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	6388	NSSAGWKISFDLAE	-7.15543	-7.26883
HLA-B14:02	3BVN	6388	NSSAGWKISFDLAE	-4.77435	-5.80965
HLA-B52:01	3W39	6388	NSSAGWKISFDLAE	-6.80875	-6.92215
HLA-B52:01	3W39	6388	NSSAGWKISFDLAE	-4.20386	-5.23916
HLA-A11:01	4UQ2	6388	NSSAGWKISFDLAE	-7.5194	-8.5547
HLA-A11:01	4UQ2	6388	NSSAGWKISFDLAE	-6.9601	-7.0735
HLA-A24:02	5HGA	6388	NSSAGWKISFDLAE	-7.52403	-7.63743
HLA-A24:02	5HGA	6388	NSSAGWKISFDLAE	-5.82433	-6.85963
HLA-B27:05	6PYJ	6388	NSSAGWKISFDLAE	-3.28285	-4.31815
HLA-B44:05	3DX8	6388	NSSAGWKISFDLAE	-5.91172	-6.94702
HLA-B44:05	3DX8	6388	NSSAGWKISFDLAE	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of FOXO3-GMDS

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
FOXO3-GMDS	chr6	108883032	chr6	1961200	12	21	KISFDLAEY	AAGATTTCCTTTGACCTCGCTGAGTAC
FOXO3-GMDS	chr6	108883032	chr6	1961200	7	16	SSAGWKISF	AGCTCTGCCGGCTGGAAGATTTCCTTT
FOXO3-GMDS	chr6	108883032	chr6	1961200	8	16	SAGWKISF	TCTGCCGGCTGGAAGATTTCCTTT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
FOXO3-GMDS	chr6	108883032	chr6	1961200	7	22	SSAGWKISFDLAEYT	AGCTCTGCCGGCTGGAAGATTTCCTTTGACCTCGCTGAGTACACT
FOXO3-GMDS	chr6	108883032	chr6	1961200	8	23	SAGWKISFDLAEYTA	TCTGCCGGCTGGAAGATTTCCTTTGACCTCGCTGAGTACACTGCG

Top

Information of the samples that have these potential fusion neoantigens of FOXO3-GMDS

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
COAD	FOXO3-GMDS	chr6	108883032	ENST00000343882	chr6	1961200	ENST00000380815	TCGA-DM-A0XF-01A

Top

Potential target of CAR-T therapy development for FOXO3-GMDS

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to FOXO3-GMDS

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to FOXO3-GMDS

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)