![]() |
|||||||
|
Fusion Protein:FOXO3-GMDS |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: FOXO3-GMDS | FusionPDB ID: 31176 | FusionGDB2.0 ID: 31176 | Hgene | Tgene | Gene symbol | FOXO3 | GMDS | Gene ID | 2309 | 2762 |
Gene name | forkhead box O3 | GDP-mannose 4,6-dehydratase | |
Synonyms | AF6q21|FKHRL1|FKHRL1P2|FOXO2|FOXO3A | GMD|SDR3E1 | |
Cytomap | 6q21 | 6p25.3 | |
Type of gene | protein-coding | protein-coding | |
Description | forkhead box protein O3forkhead box O3Aforkhead homolog (rhabdomyosarcoma) like 1forkhead in rhabdomyosarcoma-like 1forkhead, Drosophila, homolog of, in rhabdomyosarcoma-like 1 | GDP-mannose 4,6 dehydrataseGDP-D-mannose dehydrataseshort chain dehydrogenase/reductase family 3E, member 1 | |
Modification date | 20200329 | 20200313 | |
UniProtAcc | O43524 Main function of 5'-partner protein: FUNCTION: Transcriptional activator that recognizes and binds to the DNA sequence 5'-[AG]TAAA[TC]A-3' and regulates different processes, such as apoptosis and autophagy (PubMed:10102273, PubMed:16751106, PubMed:21329882). Acts as a positive regulator of autophagy in skeletal muscle: in starved cells, enters the nucleus following dephosphorylation and binds the promoters of autophagy genes, such as GABARAP1L, MAP1LC3B and ATG12, thereby activating their expression, resulting in proteolysis of skeletal muscle proteins (By similarity). Triggers apoptosis in the absence of survival factors, including neuronal cell death upon oxidative stress (PubMed:10102273, PubMed:16751106). Participates in post-transcriptional regulation of MYC: following phosphorylation by MAPKAPK5, promotes induction of miR-34b and miR-34c expression, 2 post-transcriptional regulators of MYC that bind to the 3'UTR of MYC transcript and prevent its translation (PubMed:21329882). In response to metabolic stress, translocates into the mitochondria where it promotes mtDNA transcription (PubMed:23283301). In response to metabolic stress, translocates into the mitochondria where it promotes mtDNA transcription. Also acts as a key regulator of chondrogenic commitment of skeletal progenitor cells in response to lipid availability: when lipids levels are low, translocates to the nucleus and promotes expression of SOX9, which induces chondrogenic commitment and suppresses fatty acid oxidation (By similarity). {ECO:0000250|UniProtKB:Q9WVH4, ECO:0000269|PubMed:10102273, ECO:0000269|PubMed:16751106, ECO:0000269|PubMed:21329882, ECO:0000269|PubMed:23283301}. | O60547 Main function of 5'-partner protein: FUNCTION: Catalyzes the conversion of GDP-D-mannose to GDP-4-dehydro-6-deoxy-D-mannose. {ECO:0000269|PubMed:9525924}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000343882, ENST00000406360, ENST00000540898, | ENST00000467288, ENST00000380815, ENST00000530927, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 9 X 5 X 7=315 | 14 X 10 X 8=1120 |
# samples | 12 | 15 | |
** MAII score | log2(12/315*10)=-1.39231742277876 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(15/1120*10)=-2.90046432644909 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: FOXO3 [Title/Abstract] AND GMDS [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: FOXO3 [Title/Abstract] AND GMDS [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | FOXO3(108883032)-GMDS(1961200), # samples:2 | ||
Anticipated loss of major functional domain due to fusion event. | FOXO3-GMDS seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FOXO3-GMDS seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | FOXO3 | GO:0000122 | negative regulation of transcription by RNA polymerase II | 20371612 |
Hgene | FOXO3 | GO:0006417 | regulation of translation | 21329882 |
Hgene | FOXO3 | GO:0043065 | positive regulation of apoptotic process | 20371612 |
Hgene | FOXO3 | GO:0045648 | positive regulation of erythrocyte differentiation | 14734530 |
Hgene | FOXO3 | GO:0045893 | positive regulation of transcription, DNA-templated | 10102273|15084260 |
Hgene | FOXO3 | GO:0045944 | positive regulation of transcription by RNA polymerase II | 10102273|14734530 |
Tgene | GMDS | GO:0019673 | GDP-mannose metabolic process | 9525924 |
Tgene | GMDS | GO:0042351 | 'de novo' GDP-L-fucose biosynthetic process | 9525924 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr6:108883032/chr6:1961200) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000343882 | FOXO3 | chr6 | 108883032 | + | ENST00000530927 | GMDS | chr6 | 1961200 | - | 2062 | 925 | 238 | 1698 | 486 |
ENST00000343882 | FOXO3 | chr6 | 108883032 | + | ENST00000380815 | GMDS | chr6 | 1961200 | - | 2062 | 925 | 238 | 1698 | 486 |
ENST00000406360 | FOXO3 | chr6 | 108883032 | + | ENST00000530927 | GMDS | chr6 | 1961200 | - | 2101 | 964 | 205 | 1737 | 510 |
ENST00000406360 | FOXO3 | chr6 | 108883032 | + | ENST00000380815 | GMDS | chr6 | 1961200 | - | 2101 | 964 | 205 | 1737 | 510 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000343882 | ENST00000530927 | FOXO3 | chr6 | 108883032 | + | GMDS | chr6 | 1961200 | - | 0.005954035 | 0.994046 |
ENST00000343882 | ENST00000380815 | FOXO3 | chr6 | 108883032 | + | GMDS | chr6 | 1961200 | - | 0.005954035 | 0.994046 |
ENST00000406360 | ENST00000530927 | FOXO3 | chr6 | 108883032 | + | GMDS | chr6 | 1961200 | - | 0.005406715 | 0.9945933 |
ENST00000406360 | ENST00000380815 | FOXO3 | chr6 | 108883032 | + | GMDS | chr6 | 1961200 | - | 0.005406715 | 0.9945933 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for FOXO3-GMDS |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
FOXO3 | chr6 | 108883032 | GMDS | chr6 | 1961200 | 925 | 229 | KDKGDSNSSAGWKISFDLAEYTADVD |
FOXO3 | chr6 | 108883032 | GMDS | chr6 | 1961200 | 964 | 253 | KDKGDSNSSAGWKISFDLAEYTADVD |
Top |
Potential FusionNeoAntigen Information of FOXO3-GMDS in HLA I |
![]() |
FOXO3-GMDS_108883032_1961200.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-B15:01 | KISFDLAEY | 0.9981 | 0.9338 | 12 | 21 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-B15:25 | KISFDLAEY | 0.9977 | 0.9357 | 12 | 21 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-B15:17 | SSAGWKISF | 0.9972 | 0.929 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-B57:01 | SSAGWKISF | 0.9966 | 0.9764 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-B15:16 | SSAGWKISF | 0.9956 | 0.661 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-B58:02 | SSAGWKISF | 0.9933 | 0.9627 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-B58:01 | SSAGWKISF | 0.9921 | 0.9562 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-B57:03 | SSAGWKISF | 0.9917 | 0.9615 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-A32:13 | SSAGWKISF | 0.8672 | 0.9624 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C03:08 | SSAGWKISF | 0.9976 | 0.9221 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C15:04 | SSAGWKISF | 0.9943 | 0.9387 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C03:19 | SSAGWKISF | 0.9936 | 0.9839 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-B15:07 | KISFDLAEY | 0.992 | 0.7695 | 12 | 21 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C15:06 | SSAGWKISF | 0.9832 | 0.9571 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C12:12 | SSAGWKISF | 0.976 | 0.9148 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C03:07 | SSAGWKISF | 0.976 | 0.9895 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C07:95 | SSAGWKISF | 0.9746 | 0.7085 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C03:14 | SSAGWKISF | 0.9714 | 0.9838 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-B15:05 | KISFDLAEY | 0.9657 | 0.9233 | 12 | 21 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C06:03 | SSAGWKISF | 0.882 | 0.9943 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C12:04 | SSAGWKISF | 0.8623 | 0.9962 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C02:06 | SSAGWKISF | 0.4239 | 0.9861 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C16:01 | SAGWKISF | 0.997 | 0.9798 | 8 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C03:02 | SSAGWKISF | 0.9986 | 0.9699 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-B57:04 | SSAGWKISF | 0.9984 | 0.8184 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-B15:34 | KISFDLAEY | 0.9981 | 0.9338 | 12 | 21 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-B15:125 | KISFDLAEY | 0.9981 | 0.9338 | 12 | 21 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-B15:33 | KISFDLAEY | 0.9981 | 0.9338 | 12 | 21 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-B15:27 | KISFDLAEY | 0.9981 | 0.9385 | 12 | 21 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-B15:135 | KISFDLAEY | 0.998 | 0.9379 | 12 | 21 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-B15:39 | KISFDLAEY | 0.9979 | 0.8685 | 12 | 21 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-B15:50 | KISFDLAEY | 0.9978 | 0.937 | 12 | 21 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C03:04 | SSAGWKISF | 0.9976 | 0.9905 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C03:03 | SSAGWKISF | 0.9976 | 0.9905 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-B57:10 | SSAGWKISF | 0.9966 | 0.9764 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-B58:06 | SSAGWKISF | 0.9966 | 0.8815 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C15:09 | SSAGWKISF | 0.9943 | 0.9387 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-B57:02 | SSAGWKISF | 0.994 | 0.967 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C16:04 | SSAGWKISF | 0.9936 | 0.9805 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-B15:35 | KISFDLAEY | 0.9931 | 0.931 | 12 | 21 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C03:05 | SSAGWKISF | 0.9917 | 0.9281 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C03:17 | SSAGWKISF | 0.9912 | 0.9782 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C12:02 | SSAGWKISF | 0.982 | 0.9734 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-A32:01 | SSAGWKISF | 0.978 | 0.9334 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C07:01 | SSAGWKISF | 0.9745 | 0.7132 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C12:03 | SSAGWKISF | 0.9737 | 0.983 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C15:05 | SSAGWKISF | 0.9699 | 0.9253 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-B15:20 | KISFDLAEY | 0.9675 | 0.9468 | 12 | 21 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-A25:01 | SSAGWKISF | 0.9503 | 0.823 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C15:02 | SSAGWKISF | 0.9496 | 0.9118 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C16:01 | SSAGWKISF | 0.9396 | 0.9812 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C16:02 | SSAGWKISF | 0.8121 | 0.9948 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C02:02 | SSAGWKISF | 0.5593 | 0.9862 | 7 | 16 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | HLA-C02:10 | SSAGWKISF | 0.5593 | 0.9862 | 7 | 16 |
Top |
Potential FusionNeoAntigen Information of FOXO3-GMDS in HLA II |
![]() |
FOXO3-GMDS_108883032_1961200.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | DRB1-0417 | SAGWKISFDLAEYTA | 8 | 23 |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 | DRB1-0417 | SSAGWKISFDLAEYT | 7 | 22 |
Top |
Fusion breakpoint peptide structures of FOXO3-GMDS |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
6388 | NSSAGWKISFDLAE | FOXO3 | GMDS | chr6 | 108883032 | chr6 | 1961200 | 925 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of FOXO3-GMDS |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 6388 | NSSAGWKISFDLAE | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 6388 | NSSAGWKISFDLAE | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 6388 | NSSAGWKISFDLAE | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 6388 | NSSAGWKISFDLAE | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 6388 | NSSAGWKISFDLAE | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 6388 | NSSAGWKISFDLAE | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 6388 | NSSAGWKISFDLAE | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 6388 | NSSAGWKISFDLAE | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 6388 | NSSAGWKISFDLAE | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 6388 | NSSAGWKISFDLAE | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 6388 | NSSAGWKISFDLAE | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of FOXO3-GMDS |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 12 | 21 | KISFDLAEY | AAGATTTCCTTTGACCTCGCTGAGTAC |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 7 | 16 | SSAGWKISF | AGCTCTGCCGGCTGGAAGATTTCCTTT |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 8 | 16 | SAGWKISF | TCTGCCGGCTGGAAGATTTCCTTT |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 7 | 22 | SSAGWKISFDLAEYT | AGCTCTGCCGGCTGGAAGATTTCCTTTGACCTCGCTGAGTACACT |
FOXO3-GMDS | chr6 | 108883032 | chr6 | 1961200 | 8 | 23 | SAGWKISFDLAEYTA | TCTGCCGGCTGGAAGATTTCCTTTGACCTCGCTGAGTACACTGCG |
Top |
Information of the samples that have these potential fusion neoantigens of FOXO3-GMDS |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
COAD | FOXO3-GMDS | chr6 | 108883032 | ENST00000343882 | chr6 | 1961200 | ENST00000380815 | TCGA-DM-A0XF-01A |
Top |
Potential target of CAR-T therapy development for FOXO3-GMDS |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to FOXO3-GMDS |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to FOXO3-GMDS |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |