Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:FZR1-SH3YL1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: FZR1-SH3YL1
	FusionPDB ID: 31977
	FusionGDB2.0 ID: 31977
		Hgene	Tgene
	Gene symbol	FZR1	SH3YL1
	Gene ID	51343	26751
	Gene name	fizzy and cell division cycle 20 related 1	SH3 and SYLF domain containing 1
	Synonyms	CDC20C\|CDH1\|FZR\|FZR2\|HCDH\|HCDH1	RAY
	Cytomap	19p13.3	2p25.3
	Type of gene	protein-coding	protein-coding
	Description	fizzy-related protein homologCDC20 homolog 1CDC20-like 1bCDC20-like protein 1cdh1/Hct1 homologfizzy/cell division cycle 20 related 1	SH3 domain-containing YSC84-like protein 1SH3 domain containing, Ysc84-like 1
	Modification date	20200313	20200313
	UniProtAcc	Q9UM11 Main function of 5'-partner protein: FUNCTION: Substrate-specific adapter for the anaphase promoting complex/cyclosome (APC/C) E3 ubiquitin-protein ligase complex. Associates with the APC/C in late mitosis, in replacement of CDC20, and activates the APC/C during anaphase and telophase. The APC/C remains active in degrading substrates to ensure that positive regulators of the cell cycle do not accumulate prematurely. At the G1/S transition FZR1 is phosphorylated, leading to its dissociation from the APC/C. Following DNA damage, it is required for the G2 DNA damage checkpoint: its dephosphorylation and reassociation with the APC/C leads to the ubiquitination of PLK1, preventing entry into mitosis. Acts as an adapter for APC/C to target the DNA-end resection factor RBBP8/CtIP for ubiquitination and subsequent proteasomal degradation. Through the regulation of RBBP8/CtIP protein turnover, may play a role in DNA damage response, favoring DNA double-strand repair through error-prone non-homologous end joining (NHEJ) over error-free, RBBP8-mediated homologous recombination (HR) (PubMed:25349192). {ECO:0000269\|PubMed:18662541, ECO:0000269\|PubMed:21596315, ECO:0000269\|PubMed:25349192, ECO:0000269\|PubMed:9734353}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000313639, ENST00000395095, ENST00000441788,	ENST00000468321, ENST00000402632, ENST00000403657, ENST00000415006, ENST00000356150, ENST00000403658, ENST00000403712, ENST00000405430,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	11 X 9 X 10=990	10 X 5 X 4=200
	# samples	15	10
	** MAII score	log2(15/990*10)=-2.72246602447109 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(10/200*10)=-1 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: FZR1 [Title/Abstract] AND SH3YL1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: FZR1 [Title/Abstract] AND SH3YL1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	FZR1(3523056)-SH3YL1(230044), # samples:1
Anticipated loss of major functional domain due to fusion event.	FZR1-SH3YL1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FZR1-SH3YL1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FZR1-SH3YL1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. FZR1-SH3YL1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	FZR1	GO:0031145	anaphase-promoting complex-dependent catabolic process	18662541\|21596315
Hgene	FZR1	GO:0072425	signal transduction involved in G2 DNA damage checkpoint	18662541
Hgene	FZR1	GO:1904668	positive regulation of ubiquitin protein ligase activity	11459826

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:3523056/chr2:230044)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across FZR1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across SH3YL1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000441788	FZR1	chr19	3523056	+	ENST00000403712	SH3YL1	chr2	230044	-	1250	305	209	574	121
ENST00000441788	FZR1	chr19	3523056	+	ENST00000405430	SH3YL1	chr2	230044	-	1290	305	209	631	140
ENST00000441788	FZR1	chr19	3523056	+	ENST00000356150	SH3YL1	chr2	230044	-	1285	305	209	631	140
ENST00000441788	FZR1	chr19	3523056	+	ENST00000403658	SH3YL1	chr2	230044	-	720	305	209	574	121
ENST00000313639	FZR1	chr19	3523056	+	ENST00000403712	SH3YL1	chr2	230044	-	1014	69	0	338	112
ENST00000313639	FZR1	chr19	3523056	+	ENST00000405430	SH3YL1	chr2	230044	-	1054	69	0	395	131
ENST00000313639	FZR1	chr19	3523056	+	ENST00000356150	SH3YL1	chr2	230044	-	1049	69	0	395	131
ENST00000313639	FZR1	chr19	3523056	+	ENST00000403658	SH3YL1	chr2	230044	-	484	69	0	338	112
ENST00000395095	FZR1	chr19	3523056	+	ENST00000403712	SH3YL1	chr2	230044	-	1014	69	0	338	112
ENST00000395095	FZR1	chr19	3523056	+	ENST00000405430	SH3YL1	chr2	230044	-	1054	69	0	395	131
ENST00000395095	FZR1	chr19	3523056	+	ENST00000356150	SH3YL1	chr2	230044	-	1049	69	0	395	131
ENST00000395095	FZR1	chr19	3523056	+	ENST00000403658	SH3YL1	chr2	230044	-	484	69	0	338	112

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000441788	ENST00000403712	FZR1	chr19	3523056	+	SH3YL1	chr2	230044	-	0.017746761	0.98225325
ENST00000441788	ENST00000405430	FZR1	chr19	3523056	+	SH3YL1	chr2	230044	-	0.006948783	0.9930513
ENST00000441788	ENST00000356150	FZR1	chr19	3523056	+	SH3YL1	chr2	230044	-	0.00701141	0.99298865
ENST00000441788	ENST00000403658	FZR1	chr19	3523056	+	SH3YL1	chr2	230044	-	0.0306081	0.96939194
ENST00000313639	ENST00000403712	FZR1	chr19	3523056	+	SH3YL1	chr2	230044	-	0.011945195	0.9880548
ENST00000313639	ENST00000405430	FZR1	chr19	3523056	+	SH3YL1	chr2	230044	-	0.00431679	0.9956832
ENST00000313639	ENST00000356150	FZR1	chr19	3523056	+	SH3YL1	chr2	230044	-	0.004362683	0.99563736
ENST00000313639	ENST00000403658	FZR1	chr19	3523056	+	SH3YL1	chr2	230044	-	0.016763298	0.98323673
ENST00000395095	ENST00000403712	FZR1	chr19	3523056	+	SH3YL1	chr2	230044	-	0.011945195	0.9880548
ENST00000395095	ENST00000405430	FZR1	chr19	3523056	+	SH3YL1	chr2	230044	-	0.00431679	0.9956832
ENST00000395095	ENST00000356150	FZR1	chr19	3523056	+	SH3YL1	chr2	230044	-	0.004362683	0.99563736
ENST00000395095	ENST00000403658	FZR1	chr19	3523056	+	SH3YL1	chr2	230044	-	0.016763298	0.98323673

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for FZR1-SH3YL1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
FZR1	chr19	3523056	SH3YL1	chr2	230044	305	32	RQIVIQNENTMPRAKELPPKPLSRPQ
FZR1	chr19	3523056	SH3YL1	chr2	230044	69	23	RQIVIQNENTMPRAKELPPKPLSRPQ

Top

Potential FusionNeoAntigen Information of FZR1-SH3YL1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

FZR1-SH3YL1_3523056_230044.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-B08:01	NTMPRAKEL	0.991	0.5551	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-B14:02	NTMPRAKEL	0.9645	0.6023	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-B14:01	NTMPRAKEL	0.9645	0.6023	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-B08:09	NTMPRAKEL	0.9599	0.657	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-B08:09	MPRAKELPP	0.953	0.5317	10	19
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C01:30	TMPRAKEL	0.9762	0.9576	9	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C01:17	TMPRAKEL	0.9717	0.954	9	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C03:08	NTMPRAKEL	0.9992	0.8647	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C03:07	NTMPRAKEL	0.9991	0.9108	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C15:04	NTMPRAKEL	0.999	0.7928	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C03:19	NTMPRAKEL	0.9988	0.9654	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C15:06	NTMPRAKEL	0.9987	0.8166	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-B42:02	NTMPRAKEL	0.9968	0.5533	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C04:06	NTMPRAKEL	0.9859	0.7914	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C06:03	NTMPRAKEL	0.9742	0.9912	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C12:04	NTMPRAKEL	0.9683	0.9883	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C12:12	NTMPRAKEL	0.9539	0.9467	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C02:06	NTMPRAKEL	0.9143	0.942	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C07:05	NTMPRAKEL	0.9136	0.9491	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C03:14	NTMPRAKEL	0.8964	0.9387	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C07:29	NTMPRAKEL	0.894	0.9155	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-B14:03	NTMPRAKEL	0.8926	0.7843	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C01:17	NTMPRAKEL	0.8781	0.9297	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C07:95	NTMPRAKEL	0.8163	0.6608	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C01:30	NTMPRAKEL	0.8124	0.9267	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-A30:01	RAKELPPK	0.9991	0.9168	12	20
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C01:03	TMPRAKEL	0.9769	0.9372	9	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C01:02	TMPRAKEL	0.9734	0.9518	9	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C03:04	NTMPRAKEL	0.9992	0.9694	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C03:03	NTMPRAKEL	0.9992	0.9694	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C15:09	NTMPRAKEL	0.999	0.7928	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C03:05	NTMPRAKEL	0.9984	0.9056	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C03:67	NTMPRAKEL	0.9984	0.9572	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C15:05	NTMPRAKEL	0.9981	0.8463	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C03:17	NTMPRAKEL	0.998	0.9547	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C15:02	NTMPRAKEL	0.9979	0.7729	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C03:02	NTMPRAKEL	0.9911	0.9663	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-B08:18	NTMPRAKEL	0.991	0.5551	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C06:06	NTMPRAKEL	0.9878	0.984	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C16:04	NTMPRAKEL	0.9853	0.9813	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C03:06	NTMPRAKEL	0.9839	0.9711	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C12:03	NTMPRAKEL	0.9742	0.9788	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-A68:02	NTMPRAKEL	0.9741	0.6322	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C06:02	NTMPRAKEL	0.9628	0.9875	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C06:17	NTMPRAKEL	0.9628	0.9875	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C07:04	NTMPRAKEL	0.9587	0.8778	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C07:22	NTMPRAKEL	0.9528	0.763	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-A69:01	NTMPRAKEL	0.9335	0.6481	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-B08:12	NTMPRAKEL	0.9174	0.8009	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C02:10	NTMPRAKEL	0.9163	0.9738	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C02:02	NTMPRAKEL	0.9163	0.9738	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-B07:13	NTMPRAKEL	0.9062	0.8912	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C16:02	NTMPRAKEL	0.8979	0.9839	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C01:02	NTMPRAKEL	0.8923	0.925	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C16:01	NTMPRAKEL	0.8655	0.9699	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C12:02	NTMPRAKEL	0.8633	0.9661	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C01:03	NTMPRAKEL	0.8584	0.9059	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C06:08	NTMPRAKEL	0.8578	0.9855	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C07:01	NTMPRAKEL	0.8015	0.6331	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-C17:01	NTMPRAKEL	0.389	0.8899	8	17
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	HLA-B78:02	MPRAKELPP	0.3219	0.6128	10	19

Top

Potential FusionNeoAntigen Information of FZR1-SH3YL1 in HLA II

FZR1-SH3YL1_3523056_230044.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-0303	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-0303	QIVIQNENTMPRAKE	1	16
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-0307	QIVIQNENTMPRAKE	1	16
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-0307	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-0315	QIVIQNENTMPRAKE	1	16
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-0315	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-0324	QIVIQNENTMPRAKE	1	16
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-0324	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-0326	QIVIQNENTMPRAKE	1	16
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-0342	QIVIQNENTMPRAKE	1	16
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-0342	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-0422	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-1107	QIVIQNENTMPRAKE	1	16
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-1107	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-1220	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-1406	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-1419	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-1419	QIVIQNENTMPRAKE	1	16
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-1420	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-1421	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-1421	QIVIQNENTMPRAKE	1	16
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-1429	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-1429	QIVIQNENTMPRAKE	1	16
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-1447	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-1447	QIVIQNENTMPRAKE	1	16
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-1452	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-1452	QIVIQNENTMPRAKE	1	16
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-1480	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-1483	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-1503	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-1523	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-1525	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB1-1525	QIVIQNENTMPRAKE	1	16
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB3-0201	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB3-0204	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB3-0224	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB4-0101	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB4-0103	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB4-0104	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB4-0106	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB4-0107	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB4-0108	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB5-0106	QIVIQNENTMPRAKE	1	16
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB5-0106	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB5-0111	QIVIQNENTMPRAKE	1	16
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB5-0111	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB5-0202	QIVIQNENTMPRAKE	1	16
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB5-0204	QIVIQNENTMPRAKE	1	16
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB5-0204	RQIVIQNENTMPRAK	0	15
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB5-0205	QIVIQNENTMPRAKE	1	16
FZR1-SH3YL1	chr19	3523056	chr2	230044	69	DRB5-0205	RQIVIQNENTMPRAK	0	15

Top

Fusion breakpoint peptide structures of FZR1-SH3YL1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
6143	NENTMPRAKELPPK	FZR1	SH3YL1	chr19	3523056	chr2	230044	69

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of FZR1-SH3YL1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	6143	NENTMPRAKELPPK	-6.11479	-7.15009
HLA-B14:02	3BVN	6143	NENTMPRAKELPPK	-4.76706	-4.88046
HLA-B52:01	3W39	6143	NENTMPRAKELPPK	-6.87405	-6.98745
HLA-B52:01	3W39	6143	NENTMPRAKELPPK	-5.3619	-6.3972
HLA-A11:01	4UQ2	6143	NENTMPRAKELPPK	-9.79836	-9.91176
HLA-A24:02	5HGA	6143	NENTMPRAKELPPK	-8.83847	-8.95187
HLA-A24:02	5HGA	6143	NENTMPRAKELPPK	-8.05027	-9.08557
HLA-B44:05	3DX8	6143	NENTMPRAKELPPK	-7.51915	-7.63255
HLA-B44:05	3DX8	6143	NENTMPRAKELPPK	-4.45384	-5.48914
HLA-A02:01	6TDR	6143	NENTMPRAKELPPK	-2.8902	-3.9255

Top

Vaccine Design for the FusionNeoAntigens of FZR1-SH3YL1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
FZR1-SH3YL1	chr19	3523056	chr2	230044	10	19	MPRAKELPP	ATGCCACGCGCTAAAGAATTACCTCCA
FZR1-SH3YL1	chr19	3523056	chr2	230044	12	20	RAKELPPK	CGCGCTAAAGAATTACCTCCAAAG
FZR1-SH3YL1	chr19	3523056	chr2	230044	8	17	NTMPRAKEL	AACACGATGCCACGCGCTAAAGAATTA
FZR1-SH3YL1	chr19	3523056	chr2	230044	9	17	TMPRAKEL	ACGATGCCACGCGCTAAAGAATTA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
FZR1-SH3YL1	chr19	3523056	chr2	230044	0	15	RQIVIQNENTMPRAK	CGCCAGATCGTCATCCAGAATGAGAACACGATGCCACGCGCTAAA
FZR1-SH3YL1	chr19	3523056	chr2	230044	1	16	QIVIQNENTMPRAKE	CAGATCGTCATCCAGAATGAGAACACGATGCCACGCGCTAAAGAA

Top

Information of the samples that have these potential fusion neoantigens of FZR1-SH3YL1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	FZR1-SH3YL1	chr19	3523056	ENST00000313639	chr2	230044	ENST00000356150	TCGA-IN-7808-01A

Top

Potential target of CAR-T therapy development for FZR1-SH3YL1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to FZR1-SH3YL1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to FZR1-SH3YL1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)