Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:GAK-PLEKHG2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: GAK-PLEKHG2
	FusionPDB ID: 32177
	FusionGDB2.0 ID: 32177
		Hgene	Tgene
	Gene symbol	GAK	PLEKHG2
	Gene ID	2580	64857
	Gene name	cyclin G associated kinase	pleckstrin homology and RhoGEF domain containing G2
	Synonyms	DNAJ26\|DNAJC26	ARHGEF42\|CLG\|CTB-60E11.4\|LDAMD
	Cytomap	4p16.3	19q13.2
	Type of gene	protein-coding	protein-coding
	Description	cyclin-G-associated kinaseauxilin-2	pleckstrin homology domain-containing family G member 2PH domain-containing family G member 2common-site lymphoma/leukemia guanine nucleotide exchange factorpleckstrin homology domain containing, family G (with RhoGef domain) member 2
	Modification date	20200313	20200313
	UniProtAcc	O14976 Main function of 5'-partner protein: FUNCTION: Associates with cyclin G and CDK5. Seems to act as an auxilin homolog that is involved in the uncoating of clathrin-coated vesicles by Hsc70 in non-neuronal cells. Expression oscillates slightly during the cell cycle, peaking at G1. {ECO:0000269\|PubMed:10625686}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000314167, ENST00000511163, ENST00000509566,	ENST00000378550, ENST00000409794, ENST00000409797, ENST00000425673, ENST00000458508,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	16 X 17 X 8=2176	5 X 5 X 3=75
	# samples	18	5
	** MAII score	log2(18/2176*10)=-3.59560974492067 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(5/75*10)=-0.584962500721156 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: GAK [Title/Abstract] AND PLEKHG2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: GAK [Title/Abstract] AND PLEKHG2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	GAK(891821)-PLEKHG2(39912755), # samples:1
Anticipated loss of major functional domain due to fusion event.	GAK-PLEKHG2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. GAK-PLEKHG2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. GAK-PLEKHG2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. GAK-PLEKHG2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	GAK	GO:0010977	negative regulation of neuron projection development	24510904

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr4:891821/chr19:39912755)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across GAK (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across PLEKHG2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000314167	GAK	chr4	891821	-	ENST00000409794	PLEKHG2	chr19	39912755	+	3640	762	111	3419	1102
ENST00000314167	GAK	chr4	891821	-	ENST00000378550	PLEKHG2	chr19	39912755	+	993	762	111	992	293
ENST00000314167	GAK	chr4	891821	-	ENST00000425673	PLEKHG2	chr19	39912755	+	6540	762	111	3419	1102
ENST00000314167	GAK	chr4	891821	-	ENST00000458508	PLEKHG2	chr19	39912755	+	3208	762	111	3149	1012
ENST00000314167	GAK	chr4	891821	-	ENST00000409797	PLEKHG2	chr19	39912755	+	1215	762	111	992	293
ENST00000511163	GAK	chr4	891821	-	ENST00000409794	PLEKHG2	chr19	39912755	+	3478	600	186	3257	1023
ENST00000511163	GAK	chr4	891821	-	ENST00000378550	PLEKHG2	chr19	39912755	+	831	600	186	830	214
ENST00000511163	GAK	chr4	891821	-	ENST00000425673	PLEKHG2	chr19	39912755	+	6378	600	186	3257	1023
ENST00000511163	GAK	chr4	891821	-	ENST00000458508	PLEKHG2	chr19	39912755	+	3046	600	186	2987	933
ENST00000511163	GAK	chr4	891821	-	ENST00000409797	PLEKHG2	chr19	39912755	+	1053	600	186	830	214

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000314167	ENST00000409794	GAK	chr4	891821	-	PLEKHG2	chr19	39912755	+	0.0048515	0.9951485
ENST00000314167	ENST00000378550	GAK	chr4	891821	-	PLEKHG2	chr19	39912755	+	0.006750914	0.99324906
ENST00000314167	ENST00000425673	GAK	chr4	891821	-	PLEKHG2	chr19	39912755	+	0.002287214	0.99771273
ENST00000314167	ENST00000458508	GAK	chr4	891821	-	PLEKHG2	chr19	39912755	+	0.005378032	0.994622
ENST00000314167	ENST00000409797	GAK	chr4	891821	-	PLEKHG2	chr19	39912755	+	0.004753301	0.9952467
ENST00000511163	ENST00000409794	GAK	chr4	891821	-	PLEKHG2	chr19	39912755	+	0.005876014	0.994124
ENST00000511163	ENST00000378550	GAK	chr4	891821	-	PLEKHG2	chr19	39912755	+	0.012441477	0.9875585
ENST00000511163	ENST00000425673	GAK	chr4	891821	-	PLEKHG2	chr19	39912755	+	0.002949561	0.9970504
ENST00000511163	ENST00000458508	GAK	chr4	891821	-	PLEKHG2	chr19	39912755	+	0.006840897	0.9931591
ENST00000511163	ENST00000409797	GAK	chr4	891821	-	PLEKHG2	chr19	39912755	+	0.007814669	0.9921853

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for GAK-PLEKHG2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
GAK	chr4	891821	PLEKHG2	chr19	39912755	600	138	SWSAQRRALVEEEHAGSEGELYPPES
GAK	chr4	891821	PLEKHG2	chr19	39912755	762	217	SWSAQRRALVEEEHAGSEGELYPPES

Top

Potential FusionNeoAntigen Information of GAK-PLEKHG2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

GAK-PLEKHG2_891821_39912755.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B27:05	RRALVEEEH	0.9974	0.8474	5	14
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B39:01	EHAGSEGEL	0.9963	0.9074	12	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B38:02	EHAGSEGEL	0.9937	0.9214	12	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B38:01	EHAGSEGEL	0.9926	0.9073	12	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B15:10	EHAGSEGEL	0.9768	0.559	12	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B39:06	EHAGSEGEL	0.9764	0.8535	12	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B39:24	EHAGSEGEL	0.9742	0.5003	12	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B15:37	EHAGSEGEL	0.8026	0.5618	12	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B14:02	EHAGSEGEL	0.7988	0.8979	12	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B14:01	EHAGSEGEL	0.7988	0.8979	12	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B15:18	EHAGSEGEL	0.5646	0.696	12	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B15:10	EEHAGSEGEL	0.89	0.5524	11	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B38:01	EEHAGSEGEL	0.8869	0.9163	11	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B15:18	EHAGSEGELY	0.8663	0.7134	12	22
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B38:02	EEHAGSEGEL	0.8613	0.9327	11	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B39:01	EEHAGSEGEL	0.8472	0.918	11	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B44:03	EEHAGSEGELY	0.9994	0.9671	11	22
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B38:02	EEEHAGSEGEL	0.992	0.9482	10	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B18:01	EEHAGSEGELY	0.9875	0.8487	11	22
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B27:14	RRALVEEEH	0.9968	0.8354	5	14
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B39:09	EHAGSEGEL	0.9963	0.7372	12	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B39:12	EHAGSEGEL	0.9953	0.9134	12	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B39:05	EHAGSEGEL	0.9931	0.8829	12	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B14:03	EHAGSEGEL	0.1934	0.7875	12	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B39:05	EEHAGSEGEL	0.8803	0.8937	11	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B39:05	EEEHAGSEGEL	0.9926	0.9101	10	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B27:08	RRALVEEEH	0.9971	0.7713	5	14
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B39:31	EHAGSEGEL	0.9965	0.905	12	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B38:05	EHAGSEGEL	0.9926	0.9073	12	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B15:09	EHAGSEGEL	0.9797	0.6993	12	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B39:11	EHAGSEGEL	0.7183	0.7745	12	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B39:11	EEHAGSEGEL	0.963	0.7151	11	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B38:05	EEHAGSEGEL	0.8869	0.9163	11	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B15:09	EEHAGSEGEL	0.781	0.6271	11	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B44:07	EEHAGSEGELY	0.9994	0.9671	11	22
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B44:26	EEHAGSEGELY	0.9994	0.9671	11	22
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B44:13	EEHAGSEGELY	0.9994	0.9671	11	22
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B39:11	EEEHAGSEGEL	0.9979	0.7528	10	21
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B18:11	EEHAGSEGELY	0.9949	0.8529	11	22
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B18:04	EEHAGSEGELY	0.9918	0.8472	11	22
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B18:03	EEHAGSEGELY	0.9898	0.8358	11	22
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B18:06	EEHAGSEGELY	0.988	0.8633	11	22
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B18:05	EEHAGSEGELY	0.9875	0.8487	11	22
GAK-PLEKHG2	chr4	891821	chr19	39912755	762	HLA-B15:09	EEEHAGSEGEL	0.985	0.6211	10	21

Top

Potential FusionNeoAntigen Information of GAK-PLEKHG2 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of GAK-PLEKHG2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7700	RALVEEEHAGSEGE	GAK	PLEKHG2	chr4	891821	chr19	39912755	762

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of GAK-PLEKHG2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	7700	RALVEEEHAGSEGE	-4.9963	-5.1097
HLA-B52:01	3W39	7700	RALVEEEHAGSEGE	-5.24613	-5.35953
HLA-A11:01	4UQ2	7700	RALVEEEHAGSEGE	-3.87488	-4.91018
HLA-A24:02	5HGA	7700	RALVEEEHAGSEGE	-7.5832	-7.6966
HLA-A24:02	5HGA	7700	RALVEEEHAGSEGE	-6.54552	-7.58082
HLA-B44:05	3DX8	7700	RALVEEEHAGSEGE	-5.97033	-6.08373
HLA-B44:05	3DX8	7700	RALVEEEHAGSEGE	-3.29319	-4.32849

Top

Vaccine Design for the FusionNeoAntigens of GAK-PLEKHG2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
GAK-PLEKHG2	chr4	891821	chr19	39912755	10	21	EEEHAGSEGEL	GAGGAAGAGCACGCTGGCAGCGAAGGGGAACTC
GAK-PLEKHG2	chr4	891821	chr19	39912755	11	21	EEHAGSEGEL	GAAGAGCACGCTGGCAGCGAAGGGGAACTC
GAK-PLEKHG2	chr4	891821	chr19	39912755	11	22	EEHAGSEGELY	GAAGAGCACGCTGGCAGCGAAGGGGAACTCTAC
GAK-PLEKHG2	chr4	891821	chr19	39912755	12	21	EHAGSEGEL	GAGCACGCTGGCAGCGAAGGGGAACTC
GAK-PLEKHG2	chr4	891821	chr19	39912755	12	22	EHAGSEGELY	GAGCACGCTGGCAGCGAAGGGGAACTCTAC
GAK-PLEKHG2	chr4	891821	chr19	39912755	5	14	RRALVEEEH	AGGCGAGCCCTGGTGGAGGAAGAGCAC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of GAK-PLEKHG2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
Non-Cancer	GAK-PLEKHG2	chr4	891821	ENST00000314167	chr19	39912755	ENST00000378550	TCGA-HU-A4GC-11A

Top

Potential target of CAR-T therapy development for GAK-PLEKHG2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to GAK-PLEKHG2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to GAK-PLEKHG2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)