Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:GALNT13-SMYD1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: GALNT13-SMYD1
	FusionPDB ID: 32238
	FusionGDB2.0 ID: 32238
		Hgene	Tgene
	Gene symbol	GALNT13	SMYD1
	Gene ID	117248	150572
	Gene name	polypeptide N-acetylgalactosaminyltransferase 15	SET and MYND domain containing 1
	Synonyms	GALNACT15\|GALNT13\|GALNT7\|GALNTL2\|PIH5\|pp-GalNAc-T15	BOP\|KMT3D\|ZMYND18\|ZMYND22
	Cytomap	3p25.1	2p11.2
	Type of gene	protein-coding	protein-coding
	Description	polypeptide N-acetylgalactosaminyltransferase 15UDP-GalNAc transferase T15UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase-like protein 2UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15UDP-N-acetyl-alpha-D-ga	histone-lysine N-methyltransferase SMYD1CD8 beta oppositeSET and MYND domain-containing protein 1zinc finger, MYND domain containing 18
	Modification date	20200313	20200327
	UniProtAcc	Q8IUC8 Main function of 5'-partner protein: FUNCTION: Catalyzes the initial reaction in O-linked oligosaccharide biosynthesis, the transfer of an N-acetyl-D-galactosamine residue to a serine or threonine residue on the protein receptor. Has a much stronger activity than GALNT1 to transfer GalNAc to mucin peptides, such as Muc5Ac and Muc7. Able to glycosylate SDC3. May be responsible for the synthesis of Tn antigen in neuronal cells.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000392825, ENST00000409237, ENST00000487047,	ENST00000468008, ENST00000419482, ENST00000438570, ENST00000444564,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	5 X 5 X 3=75	1 X 1 X 1=1
	# samples	5	1
	** MAII score	log2(5/75*10)=-0.584962500721156 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(1/1*10)=3.32192809488736
Fusion gene context	PubMed: GALNT13 [Title/Abstract] AND SMYD1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: GALNT13 [Title/Abstract] AND SMYD1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	GALNT13(154997018)-SMYD1(88383835), # samples:3
Anticipated loss of major functional domain due to fusion event.	GALNT13-SMYD1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. GALNT13-SMYD1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. GALNT13-SMYD1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. GALNT13-SMYD1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	SMYD1	GO:0010831	positive regulation of myotube differentiation	19783823
Tgene	SMYD1	GO:0045663	positive regulation of myoblast differentiation	19783823

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:154997018/chr2:88383835)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across GALNT13 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across SMYD1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000392825	GALNT13	chr2	154997018	+	ENST00000419482	SMYD1	chr2	88383835	+	5089	878	567	2213	548
ENST00000392825	GALNT13	chr2	154997018	+	ENST00000444564	SMYD1	chr2	88383835	+	2517	878	567	2174	535
ENST00000392825	GALNT13	chr2	154997018	+	ENST00000438570	SMYD1	chr2	88383835	+	1418	878	567	1052	161
ENST00000409237	GALNT13	chr2	154997018	+	ENST00000419482	SMYD1	chr2	88383835	+	4522	311	0	1646	548
ENST00000409237	GALNT13	chr2	154997018	+	ENST00000444564	SMYD1	chr2	88383835	+	1950	311	0	1607	535
ENST00000409237	GALNT13	chr2	154997018	+	ENST00000438570	SMYD1	chr2	88383835	+	851	311	0	485	161

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000392825	ENST00000419482	GALNT13	chr2	154997018	+	SMYD1	chr2	88383835	+	0.001425134	0.99857485
ENST00000392825	ENST00000444564	GALNT13	chr2	154997018	+	SMYD1	chr2	88383835	+	0.003830809	0.99616915
ENST00000392825	ENST00000438570	GALNT13	chr2	154997018	+	SMYD1	chr2	88383835	+	0.011301792	0.9886982
ENST00000409237	ENST00000419482	GALNT13	chr2	154997018	+	SMYD1	chr2	88383835	+	0.00088779	0.9991122
ENST00000409237	ENST00000444564	GALNT13	chr2	154997018	+	SMYD1	chr2	88383835	+	0.002960324	0.9970396
ENST00000409237	ENST00000438570	GALNT13	chr2	154997018	+	SMYD1	chr2	88383835	+	0.009426267	0.9905737

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for GALNT13-SMYD1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
GALNT13	chr2	154997018	SMYD1	chr2	88383835	311	104	ALNRSLPDVRLEGLVNFVCHTCFKRQ
GALNT13	chr2	154997018	SMYD1	chr2	88383835	878	104	ALNRSLPDVRLEGLVNFVCHTCFKRQ

Top

Potential FusionNeoAntigen Information of GALNT13-SMYD1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

GALNT13-SMYD1_154997018_88383835.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B27:02	VRLEGLVNF	0.9998	0.786	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B27:05	VRLEGLVNF	0.9997	0.9464	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B27:04	VRLEGLVNF	0.9997	0.8751	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B27:07	VRLEGLVNF	0.9987	0.7222	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B07:02	LPDVRLEGL	0.9984	0.672	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B07:05	LPDVRLEGL	0.9982	0.681	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A02:11	RLEGLVNFV	0.9918	0.8108	9	18
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A02:67	RLEGLVNFV	0.9915	0.802	9	18
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A02:24	RLEGLVNFV	0.9915	0.802	9	18
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A02:60	RLEGLVNFV	0.9915	0.7858	9	18
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A02:30	RLEGLVNFV	0.9915	0.802	9	18
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A02:22	RLEGLVNFV	0.9876	0.7437	9	18
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A02:16	RLEGLVNFV	0.9822	0.7286	9	18
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A02:27	RLEGLVNFV	0.9816	0.7994	9	18
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A02:13	RLEGLVNFV	0.9779	0.8167	9	18
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B35:03	LPDVRLEGL	0.9769	0.9162	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A02:38	RLEGLVNFV	0.9734	0.7545	9	18
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A02:04	RLEGLVNFV	0.9652	0.8201	9	18
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B35:08	LPDVRLEGL	0.9563	0.9214	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A02:35	RLEGLVNFV	0.9191	0.8088	9	18
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B35:02	LPDVRLEGL	0.8956	0.9645	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B35:04	LPDVRLEGL	0.8956	0.9645	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A02:19	RLEGLVNFV	0.8725	0.5876	9	18
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B08:01	LPDVRLEGL	0.869	0.7785	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A02:29	RLEGLVNFV	0.8429	0.8027	9	18
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B08:09	LPDVRLEGL	0.8315	0.8246	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A02:20	RLEGLVNFV	0.8169	0.8034	9	18
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B38:02	VRLEGLVNF	0.6783	0.9859	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B38:01	VRLEGLVNF	0.6635	0.9839	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B81:01	LPDVRLEGL	0.5169	0.7085	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B15:03	VRLEGLVNF	0.468	0.8532	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B15:18	VRLEGLVNF	0.4454	0.8288	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B82:01	LPDVRLEGL	0.3135	0.8324	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B13:02	RLEGLVNFV	0.1558	0.8103	9	18
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A26:02	DVRLEGLVNF	0.9925	0.7199	7	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A02:22	SLPDVRLEGL	0.9834	0.7436	4	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A26:15	DVRLEGLVNF	0.983	0.736	7	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A26:14	DVRLEGLVNF	0.983	0.736	7	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A26:03	DVRLEGLVNF	0.9616	0.7353	7	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A02:17	SLPDVRLEGL	0.8713	0.772	4	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A02:19	SLPDVRLEGL	0.8511	0.7151	4	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A26:08	DVRLEGLVNF	0.5914	0.5251	7	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B57:01	RSLPDVRLEGL	0.9998	0.9906	3	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B58:02	RSLPDVRLEGL	0.9997	0.9717	3	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B58:01	RSLPDVRLEGL	0.9992	0.9739	3	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B57:03	RSLPDVRLEGL	0.9992	0.993	3	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B27:14	VRLEGLVNF	0.9997	0.8595	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-C04:10	LPDVRLEGL	0.9993	0.9146	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-C04:07	LPDVRLEGL	0.9993	0.9194	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-C07:05	VRLEGLVNF	0.9981	0.9683	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-C07:95	VRLEGLVNF	0.9981	0.8359	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-C07:27	VRLEGLVNF	0.9966	0.9777	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B14:03	LPDVRLEGL	0.9947	0.9097	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-C07:29	VRLEGLVNF	0.9934	0.9749	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B07:12	LPDVRLEGL	0.9933	0.7782	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A02:01	RLEGLVNFV	0.9915	0.802	9	18
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A02:07	RLEGLVNFV	0.9907	0.8145	9	18
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B27:03	VRLEGLVNF	0.9904	0.9532	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A02:02	RLEGLVNFV	0.9875	0.5018	9	18
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-C07:67	VRLEGLVNF	0.9591	0.9783	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-C07:80	VRLEGLVNF	0.9591	0.9783	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-C07:19	VRLEGLVNF	0.9581	0.9108	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-C07:46	VRLEGLVNF	0.9576	0.9603	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-C07:13	VRLEGLVNF	0.9548	0.9676	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B56:04	LPDVRLEGL	0.9499	0.5755	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B42:02	LPDVRLEGL	0.9108	0.776	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B07:04	LPDVRLEGL	0.9086	0.6523	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B42:01	LPDVRLEGL	0.9056	0.7701	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-C07:10	VRLEGLVNF	0.8984	0.9825	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B35:12	LPDVRLEGL	0.8956	0.9645	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B39:12	VRLEGLVNF	0.8152	0.9045	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B39:10	LPDVRLEGL	0.7858	0.9671	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B39:09	LPDVRLEGL	0.7728	0.9304	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-C12:16	VRLEGLVNF	0.1207	0.9741	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A02:02	SLPDVRLEGL	0.985	0.5918	4	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A26:01	DVRLEGLVNF	0.983	0.736	7	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-C01:17	SLPDVRLEGL	0.9792	0.9857	4	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A02:05	SLPDVRLEGL	0.9769	0.6842	4	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-C01:30	SLPDVRLEGL	0.9695	0.9814	4	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A02:07	SLPDVRLEGL	0.8986	0.77	4	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A02:07	SLPDVRLEGLV	0.9169	0.7678	4	15
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B27:06	VRLEGLVNF	0.9997	0.8252	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B27:08	VRLEGLVNF	0.9997	0.8914	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B27:10	VRLEGLVNF	0.9997	0.9412	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-C04:01	LPDVRLEGL	0.9993	0.9194	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B07:22	LPDVRLEGL	0.9984	0.672	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-C07:01	VRLEGLVNF	0.9983	0.829	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B27:09	VRLEGLVNF	0.9974	0.9416	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-C07:17	VRLEGLVNF	0.9915	0.9792	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A02:03	RLEGLVNFV	0.9872	0.8081	9	18
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B35:13	LPDVRLEGL	0.9713	0.919	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-C07:02	VRLEGLVNF	0.9591	0.9783	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B56:02	LPDVRLEGL	0.9499	0.5755	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B59:01	LPDVRLEGL	0.9381	0.6114	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-C07:22	VRLEGLVNF	0.9337	0.7914	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-C06:08	VRLEGLVNF	0.9201	0.9932	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B35:22	LPDVRLEGL	0.9071	0.5066	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B35:09	LPDVRLEGL	0.8956	0.9645	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B55:04	LPDVRLEGL	0.8935	0.6694	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B08:18	LPDVRLEGL	0.869	0.7785	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B67:01	LPDVRLEGL	0.7957	0.9684	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B39:31	VRLEGLVNF	0.7906	0.9009	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B08:12	LPDVRLEGL	0.77	0.8775	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B38:05	VRLEGLVNF	0.6635	0.9839	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B82:02	LPDVRLEGL	0.3135	0.8324	5	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-C06:06	VRLEGLVNF	0.2552	0.9924	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-C03:67	VRLEGLVNF	0.1834	0.9833	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B15:68	VRLEGLVNF	0.1443	0.7377	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-C06:17	VRLEGLVNF	0.063	0.9949	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-C06:02	VRLEGLVNF	0.063	0.9949	8	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-C01:03	SLPDVRLEGL	0.9928	0.9844	4	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-A25:01	DVRLEGLVNF	0.9918	0.9414	7	17
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-C01:02	SLPDVRLEGL	0.9846	0.9852	4	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B57:10	RSLPDVRLEGL	0.9998	0.9906	3	14
GALNT13-SMYD1	chr2	154997018	chr2	88383835	878	HLA-B58:06	RSLPDVRLEGL	0.9996	0.9358	3	14

Top

Potential FusionNeoAntigen Information of GALNT13-SMYD1 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of GALNT13-SMYD1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
6563	PDVRLEGLVNFVCH	GALNT13	SMYD1	chr2	154997018	chr2	88383835	878

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of GALNT13-SMYD1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	6563	PDVRLEGLVNFVCH	-7.9962	-8.1096
HLA-B14:02	3BVN	6563	PDVRLEGLVNFVCH	-5.70842	-6.74372
HLA-B52:01	3W39	6563	PDVRLEGLVNFVCH	-6.83737	-6.95077
HLA-B52:01	3W39	6563	PDVRLEGLVNFVCH	-4.4836	-5.5189
HLA-A11:01	4UQ2	6563	PDVRLEGLVNFVCH	-10.0067	-10.1201
HLA-A11:01	4UQ2	6563	PDVRLEGLVNFVCH	-9.03915	-10.0745
HLA-A24:02	5HGA	6563	PDVRLEGLVNFVCH	-6.56204	-6.67544
HLA-A24:02	5HGA	6563	PDVRLEGLVNFVCH	-5.42271	-6.45801
HLA-B44:05	3DX8	6563	PDVRLEGLVNFVCH	-7.85648	-8.89178
HLA-B44:05	3DX8	6563	PDVRLEGLVNFVCH	-5.3978	-5.5112
HLA-A02:01	6TDR	6563	PDVRLEGLVNFVCH	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of GALNT13-SMYD1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
GALNT13-SMYD1	chr2	154997018	chr2	88383835	3	14	RSLPDVRLEGL	TAGAAGTCTGCCAGATGTAAGATTAGAAGGCCT
GALNT13-SMYD1	chr2	154997018	chr2	88383835	4	14	SLPDVRLEGL	AAGTCTGCCAGATGTAAGATTAGAAGGCCT
GALNT13-SMYD1	chr2	154997018	chr2	88383835	4	15	SLPDVRLEGLV	AAGTCTGCCAGATGTAAGATTAGAAGGCCTTGT
GALNT13-SMYD1	chr2	154997018	chr2	88383835	5	14	LPDVRLEGL	TCTGCCAGATGTAAGATTAGAAGGCCT
GALNT13-SMYD1	chr2	154997018	chr2	88383835	7	17	DVRLEGLVNF	AGATGTAAGATTAGAAGGCCTTGTTAATTT
GALNT13-SMYD1	chr2	154997018	chr2	88383835	8	17	VRLEGLVNF	TGTAAGATTAGAAGGCCTTGTTAATTT
GALNT13-SMYD1	chr2	154997018	chr2	88383835	9	18	RLEGLVNFV	AAGATTAGAAGGCCTTGTTAATTTTGT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of GALNT13-SMYD1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
SARC	GALNT13-SMYD1	chr2	154997018	ENST00000392825	chr2	88383835	ENST00000419482	TCGA-K1-A6RV-01A

Top

Potential target of CAR-T therapy development for GALNT13-SMYD1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Hgene

GALNT13

chr2:154997018

chr2:88383835

ENST00000392825

5_27

103

557.0

Transmembrane

Helical%3B Signal-anchor for type II membrane protein

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to GALNT13-SMYD1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to GALNT13-SMYD1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)