Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:GALNTL6-BARD1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: GALNTL6-BARD1
	FusionPDB ID: 32323
	FusionGDB2.0 ID: 32323
		Hgene	Tgene
	Gene symbol	GALNTL6	BARD1
	Gene ID	442117	580
	Gene name	polypeptide N-acetylgalactosaminyltransferase like 6	BRCA1 associated RING domain 1
	Synonyms	GALNACT20\|GALNT17\|GalNAc-T6L	-
	Cytomap	4q34.1	2q35
	Type of gene	protein-coding	protein-coding
	Description	polypeptide N-acetylgalactosaminyltransferase-like 6GaNTase 17GalNAc transferase 17UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase 17UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 20UDP-N-acetyl-alpha-D-gala	BRCA1-associated RING domain protein 1BRCA1-associated RING domain gene 1RING-type E3 ubiquitin transferase BARD1
	Modification date	20200313	20200322
	UniProtAcc	Q49A17 Main function of 5'-partner protein: FUNCTION: Catalyzes the initial reaction in O-linked oligosaccharide biosynthesis, the transfer of an N-acetyl-D-galactosamine residue to a serine or threonine residue on the protein receptor. {ECO:0000250}.	Q99728 Main function of 5'-partner protein: FUNCTION: E3 ubiquitin-protein ligase. The BRCA1-BARD1 heterodimer specifically mediates the formation of 'Lys-6'-linked polyubiquitin chains and coordinates a diverse range of cellular pathways such as DNA damage repair, ubiquitination and transcriptional regulation to maintain genomic stability. Plays a central role in the control of the cell cycle in response to DNA damage. Acts by mediating ubiquitin E3 ligase activity that is required for its tumor suppressor function. Also forms a heterodimer with CSTF1/CSTF-50 to modulate mRNA processing and RNAP II stability by inhibiting pre-mRNA 3' cleavage. {ECO:0000269\|PubMed:12890688, ECO:0000269\|PubMed:14976165, ECO:0000269\|PubMed:20351172}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000506823, ENST00000511251, ENST00000457021, ENST00000508122,	ENST00000432456, ENST00000471787, ENST00000260947, ENST00000449967,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	7 X 7 X 2=98	4 X 4 X 3=48
	# samples	7	4
	** MAII score	log2(7/98*10)=-0.485426827170242 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(4/48*10)=-0.263034405833794 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: GALNTL6 [Title/Abstract] AND BARD1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: GALNTL6 [Title/Abstract] AND BARD1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	GALNTL6(172735869)-BARD1(215634036), # samples:1
Anticipated loss of major functional domain due to fusion event.	GALNTL6-BARD1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. GALNTL6-BARD1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. GALNTL6-BARD1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. GALNTL6-BARD1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	GALNTL6	GO:0018243	protein O-linked glycosylation via threonine	22186971
Tgene	BARD1	GO:0046826	negative regulation of protein export from nucleus	15265711
Tgene	BARD1	GO:0085020	protein K6-linked ubiquitination	12890688\|20351172

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr4:172735869/chr2:215634036)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across GALNTL6 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across BARD1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000506823	GALNTL6	chr4	172735869	+	ENST00000260947	BARD1	chr2	215634036	-	4845	795	279	1814	511
ENST00000506823	GALNTL6	chr4	172735869	+	ENST00000449967	BARD1	chr2	215634036	-	1783	795	279	1616	445
ENST00000511251	GALNTL6	chr4	172735869	+	ENST00000260947	BARD1	chr2	215634036	-	6648	2598	2676	3617	313
ENST00000511251	GALNTL6	chr4	172735869	+	ENST00000449967	BARD1	chr2	215634036	-	3586	2598	2676	3419	247

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000506823	ENST00000260947	GALNTL6	chr4	172735869	+	BARD1	chr2	215634036	-	0.000141112	0.99985886
ENST00000506823	ENST00000449967	GALNTL6	chr4	172735869	+	BARD1	chr2	215634036	-	0.004324224	0.99567574
ENST00000511251	ENST00000260947	GALNTL6	chr4	172735869	+	BARD1	chr2	215634036	-	0.003287919	0.9967121
ENST00000511251	ENST00000449967	GALNTL6	chr4	172735869	+	BARD1	chr2	215634036	-	0.067894995	0.93210506

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for GALNTL6-BARD1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
GALNTL6	chr4	172735869	BARD1	chr2	215634036	795	172	KHLVKSAEPGEQQGDIPSVEYLLQNG

Top

Potential FusionNeoAntigen Information of GALNTL6-BARD1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

GALNTL6-BARD1_172735869_215634036.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B13:02	QQGDIPSV	0.9872	0.9184	11	19
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B35:08	QGDIPSVEY	0.8829	0.9063	12	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B35:01	QGDIPSVEY	0.8335	0.896	12	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B13:02	EQQGDIPSV	0.7478	0.8989	10	19
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B39:13	EQQGDIPSV	0.7346	0.9851	10	19
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B13:01	EQQGDIPSV	0.6562	0.9826	10	19
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-A02:21	EQQGDIPSV	0.5477	0.7023	10	19
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-A02:19	EQQGDIPSV	0.1143	0.5307	10	19
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:01	QQGDIPSVEY	0.9996	0.8548	11	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B40:02	GEQQGDIPSV	0.9968	0.5809	9	19
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B45:01	GEQQGDIPSV	0.9812	0.9905	9	19
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:25	QQGDIPSVEY	0.9787	0.9126	11	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B13:02	GEQQGDIPSV	0.9766	0.9652	9	19
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:02	QQGDIPSVEY	0.9539	0.9297	11	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:03	QQGDIPSVEY	0.7925	0.7992	11	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-A02:21	GEQQGDIPSV	0.7595	0.597	9	19
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B41:01	GEQQGDIPSV	0.6007	0.9807	9	19
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:01	EQQGDIPSVEY	0.9991	0.7614	10	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B48:01	QQGDIPSVEYL	0.9931	0.74	11	22
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:02	EQQGDIPSVEY	0.9919	0.8544	10	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B13:01	QQGDIPSVEYL	0.9519	0.9587	11	22
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-C04:10	QGDIPSVEY	0.9869	0.8008	12	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-C05:09	QGDIPSVEY	0.9862	0.9473	12	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-C04:07	QGDIPSVEY	0.986	0.8495	12	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-C08:15	QGDIPSVEY	0.8768	0.9612	12	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:31	QGDIPSVEY	0.8383	0.913	12	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B39:05	EQQGDIPSV	0.6871	0.9719	10	19
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-A02:05	EQQGDIPSV	0.6046	0.5525	10	19
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B51:07	EQQGDIPSV	0.2607	0.9721	10	19
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B40:06	GEQQGDIPSV	0.9967	0.9761	9	19
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:07	QQGDIPSVEY	0.9889	0.7258	11	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:21	QQGDIPSVEY	0.9587	0.8687	11	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:05	QQGDIPSVEY	0.9162	0.8837	11	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:31	QQGDIPSVEY	0.8433	0.8965	11	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:21	EQQGDIPSVEY	0.9927	0.7997	10	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:05	EQQGDIPSVEY	0.987	0.7481	10	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:31	EQQGDIPSVEY	0.985	0.7625	10	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B48:03	QQGDIPSVEYL	0.9133	0.5914	11	22
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-C04:03	QGDIPSVEY	0.9876	0.8884	12	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-C05:01	QGDIPSVEY	0.9862	0.9473	12	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-C04:01	QGDIPSVEY	0.986	0.8495	12	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-C08:02	QGDIPSVEY	0.8768	0.9612	12	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B35:23	QGDIPSVEY	0.8342	0.9101	12	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B35:77	QGDIPSVEY	0.8335	0.896	12	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B35:20	QGDIPSVEY	0.8248	0.9625	12	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B39:02	EQQGDIPSV	0.7457	0.9843	10	19
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B39:11	EQQGDIPSV	0.6075	0.9428	10	19
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-A02:14	EQQGDIPSV	0.5555	0.6364	10	19
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-A02:06	EQQGDIPSV	0.5477	0.7023	10	19
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:34	QQGDIPSVEY	0.9996	0.8548	11	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:33	QQGDIPSVEY	0.9996	0.8548	11	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:125	QQGDIPSVEY	0.9996	0.8548	11	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:27	QQGDIPSVEY	0.9995	0.8556	11	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:135	QQGDIPSVEY	0.9995	0.8779	11	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:50	QQGDIPSVEY	0.9994	0.8379	11	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:24	QQGDIPSVEY	0.9979	0.9057	11	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B40:40	GEQQGDIPSV	0.9967	0.6251	9	19
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:12	QQGDIPSVEY	0.9959	0.7989	11	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:53	QQGDIPSVEY	0.9932	0.8267	11	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:35	QQGDIPSVEY	0.9884	0.8542	11	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:54	QQGDIPSVEY	0.9883	0.8044	11	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B40:04	GEQQGDIPSV	0.9868	0.9116	9	19
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:39	QQGDIPSVEY	0.9775	0.8463	11	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B40:36	GEQQGDIPSV	0.9744	0.8899	9	19
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:20	QQGDIPSVEY	0.9185	0.9348	11	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B35:28	QQGDIPSVEY	0.8925	0.9473	11	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B35:20	QQGDIPSVEY	0.8225	0.9548	11	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:68	QQGDIPSVEY	0.7796	0.6585	11	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-A02:06	GEQQGDIPSV	0.7595	0.597	9	19
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-A02:14	GEQQGDIPSV	0.7579	0.5042	9	19
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B18:04	QQGDIPSVEY	0.6928	0.8727	11	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B41:03	GEQQGDIPSV	0.6498	0.9155	9	19
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B48:02	QQGDIPSVEY	0.6475	0.935	11	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:125	EQQGDIPSVEY	0.9991	0.7614	10	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:33	EQQGDIPSVEY	0.9991	0.7614	10	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:34	EQQGDIPSVEY	0.9991	0.7614	10	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:135	EQQGDIPSVEY	0.999	0.7691	10	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:27	EQQGDIPSVEY	0.9988	0.8011	10	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:53	EQQGDIPSVEY	0.9977	0.7388	10	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:50	EQQGDIPSVEY	0.9969	0.8126	10	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:12	EQQGDIPSVEY	0.996	0.86	10	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B15:20	EQQGDIPSVEY	0.9874	0.8064	10	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B35:28	EQQGDIPSVEY	0.9815	0.8377	10	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B35:20	EQQGDIPSVEY	0.9791	0.8582	10	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B40:21	QQGDIPSVEYL	0.9479	0.6489	11	22
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B18:04	EQQGDIPSVEY	0.9352	0.8435	10	21
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B40:12	QQGDIPSVEYL	0.9133	0.5914	11	22
GALNTL6-BARD1	chr4	172735869	chr2	215634036	795	HLA-B48:02	EQQGDIPSVEY	0.8608	0.802	10	21

Top

Potential FusionNeoAntigen Information of GALNTL6-BARD1 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of GALNTL6-BARD1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
167	AEPGEQQGDIPSVE	GALNTL6	BARD1	chr4	172735869	chr2	215634036	795

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of GALNTL6-BARD1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	167	AEPGEQQGDIPSVE	-8.31227	-8.42567
HLA-B14:02	3BVN	167	AEPGEQQGDIPSVE	-5.57336	-6.60866
HLA-B52:01	3W39	167	AEPGEQQGDIPSVE	-6.32748	-6.44088
HLA-B52:01	3W39	167	AEPGEQQGDIPSVE	-5.21657	-6.25187
HLA-A24:02	5HGA	167	AEPGEQQGDIPSVE	-6.95203	-7.06543
HLA-A24:02	5HGA	167	AEPGEQQGDIPSVE	-5.804	-6.8393
HLA-B44:05	3DX8	167	AEPGEQQGDIPSVE	-6.02771	-6.14111
HLA-B44:05	3DX8	167	AEPGEQQGDIPSVE	-3.1424	-4.1777

Top

Vaccine Design for the FusionNeoAntigens of GALNTL6-BARD1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
GALNTL6-BARD1	chr4	172735869	chr2	215634036	10	19	EQQGDIPSV	GAGCAGCAGGGCGACATACCTTCTGTT
GALNTL6-BARD1	chr4	172735869	chr2	215634036	10	21	EQQGDIPSVEY	GAGCAGCAGGGCGACATACCTTCTGTTGAATAC
GALNTL6-BARD1	chr4	172735869	chr2	215634036	11	19	QQGDIPSV	CAGCAGGGCGACATACCTTCTGTT
GALNTL6-BARD1	chr4	172735869	chr2	215634036	11	21	QQGDIPSVEY	CAGCAGGGCGACATACCTTCTGTTGAATAC
GALNTL6-BARD1	chr4	172735869	chr2	215634036	11	22	QQGDIPSVEYL	CAGCAGGGCGACATACCTTCTGTTGAATACCTT
GALNTL6-BARD1	chr4	172735869	chr2	215634036	12	21	QGDIPSVEY	CAGGGCGACATACCTTCTGTTGAATAC
GALNTL6-BARD1	chr4	172735869	chr2	215634036	9	19	GEQQGDIPSV	GGGGAGCAGCAGGGCGACATACCTTCTGTT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of GALNTL6-BARD1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	GALNTL6-BARD1	chr4	172735869	ENST00000506823	chr2	215634036	ENST00000260947	TCGA-FP-8209-01A

Top

Potential target of CAR-T therapy development for GALNTL6-BARD1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Hgene

GALNTL6

chr4:172735869

chr2:215634036

ENST00000506823

8_28

602.0

Transmembrane

Helical%3B Signal-anchor for type II membrane protein

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to GALNTL6-BARD1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to GALNTL6-BARD1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)