|
|||||||
|
Fusion Protein:AKAP13-SPI1 |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: AKAP13-SPI1 | FusionPDB ID: 3320 | FusionGDB2.0 ID: 3320 | Hgene | Tgene | Gene symbol | AKAP13 | SPI1 | Gene ID | 11214 | 6688 |
| Gene name | A-kinase anchoring protein 13 | Spi-1 proto-oncogene | |
| Synonyms | AKAP-13|AKAP-Lbc|ARHGEF13|BRX|HA-3|Ht31|LBC|PRKA13|PROTO-LB|PROTO-LBC|c-lbc|p47 | OF|PU.1|SFPI1|SPI-1|SPI-A | |
| Cytomap | 15q25.3 | 11p11.2 | |
| Type of gene | protein-coding | protein-coding | |
| Description | A-kinase anchor protein 13A kinase (PRKA) anchor protein 13LBC oncogenebreast cancer nuclear receptor-binding auxiliary proteinguanine nucleotide exchange factor Lbchuman thyroid-anchoring protein 31lymphoid blast crisis oncogenenon-oncogenic Rho G | transcription factor PU.131 kDa transforming proteinhematopoietic transcription factor PU.1spleen focus forming virus (SFFV) proviral integration oncogene spi1 | |
| Modification date | 20200313 | 20200313 | |
| UniProtAcc | Q12802 Main function of 5'-partner protein: FUNCTION: Scaffold protein that plays an important role in assembling signaling complexes downstream of several types of G protein-coupled receptors. Activates RHOA in response to signaling via G protein-coupled receptors via its function as Rho guanine nucleotide exchange factor (PubMed:11546812, PubMed:15229649, PubMed:23090968, PubMed:25186459, PubMed:24993829). May also activate other Rho family members (PubMed:11546812). Part of a kinase signaling complex that links ADRA1A and ADRA1B adrenergic receptor signaling to the activation of downstream p38 MAP kinases, such as MAPK11 and MAPK14 (PubMed:17537920, PubMed:23716597, PubMed:21224381). Part of a signaling complex that links ADRA1B signaling to the activation of RHOA and IKBKB/IKKB, leading to increased NF-kappa-B transcriptional activity (PubMed:23090968). Part of a RHOA-dependent signaling cascade that mediates responses to lysophosphatidic acid (LPA), a signaling molecule that activates G-protein coupled receptors and potentiates transcriptional activation of the glucocorticoid receptor NR3C1 (PubMed:16469733). Part of a signaling cascade that stimulates MEF2C-dependent gene expression in response to lysophosphatidic acid (LPA) (By similarity). Part of a signaling pathway that activates MAPK11 and/or MAPK14 and leads to increased transcription activation of the estrogen receptors ESR1 and ESR2 (PubMed:9627117, PubMed:11579095). Part of a signaling cascade that links cAMP and EGFR signaling to BRAF signaling and to PKA-mediated phosphorylation of KSR1, leading to the activation of downstream MAP kinases, such as MAPK1 or MAPK3 (PubMed:21102438). Functions as scaffold protein that anchors cAMP-dependent protein kinase (PKA) and PRKD1. This promotes activation of PRKD1, leading to increased phosphorylation of HDAC5 and ultimately cardiomyocyte hypertrophy (By similarity). Has no guanine nucleotide exchange activity on CDC42, Ras or Rac (PubMed:11546812). Required for normal embryonic heart development, and in particular for normal sarcomere formation in the developing cardiomyocytes (By similarity). Plays a role in cardiomyocyte growth and cardiac hypertrophy in response to activation of the beta-adrenergic receptor by phenylephrine or isoproterenol (PubMed:17537920, PubMed:23090968). Required for normal adaptive cardiac hypertrophy in response to pressure overload (PubMed:23716597). Plays a role in osteogenesis (By similarity). {ECO:0000250|UniProtKB:E9Q394, ECO:0000269|PubMed:11546812, ECO:0000269|PubMed:11579095, ECO:0000269|PubMed:17537920, ECO:0000269|PubMed:21224381, ECO:0000269|PubMed:23716597, ECO:0000269|PubMed:24993829, ECO:0000269|PubMed:25186459, ECO:0000269|PubMed:9627117, ECO:0000269|PubMed:9891067}. | . | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000361243, ENST00000394518, ENST00000394510, ENST00000560302, ENST00000560579, | ENST00000533030, ENST00000533968, ENST00000227163, ENST00000378538, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 37 X 24 X 13=11544 | 5 X 5 X 3=75 |
| # samples | 41 | 6 | |
| ** MAII score | log2(41/11544*10)=-4.81537548498575 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(6/75*10)=-0.321928094887362 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: AKAP13 [Title/Abstract] AND SPI1 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: AKAP13 [Title/Abstract] AND SPI1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | AKAP13(86129054)-SPI1(47380557), # samples:1 | ||
| Anticipated loss of major functional domain due to fusion event. | AKAP13-SPI1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. AKAP13-SPI1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. AKAP13-SPI1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. AKAP13-SPI1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | AKAP13 | GO:0007186 | G protein-coupled receptor signaling pathway | 11546812 |
| Hgene | AKAP13 | GO:0035025 | positive regulation of Rho protein signal transduction | 11546812 |
| Tgene | SPI1 | GO:0044027 | hypermethylation of CpG island | 20139074 |
| Tgene | SPI1 | GO:0045814 | negative regulation of gene expression, epigenetic | 20139074 |
| Tgene | SPI1 | GO:0045892 | negative regulation of transcription, DNA-templated | 20139074 |
| Tgene | SPI1 | GO:0045893 | positive regulation of transcription, DNA-templated | 12833137 |
| Tgene | SPI1 | GO:0061614 | pri-miRNA transcription by RNA polymerase II | 20972335 |
| Tgene | SPI1 | GO:0070102 | interleukin-6-mediated signaling pathway | 24429361 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr15:86129054/chr11:47380557) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across AKAP13 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across SPI1 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000394518 | AKAP13 | chr15 | 86129054 | + | ENST00000378538 | SPI1 | chr11 | 47380557 | - | 5106 | 4256 | 95 | 4738 | 1547 |
| ENST00000394518 | AKAP13 | chr15 | 86129054 | + | ENST00000227163 | SPI1 | chr11 | 47380557 | - | 5053 | 4256 | 95 | 4738 | 1547 |
| ENST00000361243 | AKAP13 | chr15 | 86129054 | + | ENST00000378538 | SPI1 | chr11 | 47380557 | - | 5092 | 4242 | 81 | 4724 | 1547 |
| ENST00000361243 | AKAP13 | chr15 | 86129054 | + | ENST00000227163 | SPI1 | chr11 | 47380557 | - | 5039 | 4242 | 81 | 4724 | 1547 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000394518 | ENST00000378538 | AKAP13 | chr15 | 86129054 | + | SPI1 | chr11 | 47380557 | - | 0.001751167 | 0.9982488 |
| ENST00000394518 | ENST00000227163 | AKAP13 | chr15 | 86129054 | + | SPI1 | chr11 | 47380557 | - | 0.001899721 | 0.99810034 |
| ENST00000361243 | ENST00000378538 | AKAP13 | chr15 | 86129054 | + | SPI1 | chr11 | 47380557 | - | 0.001716615 | 0.9982834 |
| ENST00000361243 | ENST00000227163 | AKAP13 | chr15 | 86129054 | + | SPI1 | chr11 | 47380557 | - | 0.001867707 | 0.9981323 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for AKAP13-SPI1 |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| AKAP13 | chr15 | 86129054 | SPI1 | chr11 | 47380557 | 4242 | 1387 | ATLKMKQGPMTQAVSYLPRMCLQYPS |
| AKAP13 | chr15 | 86129054 | SPI1 | chr11 | 47380557 | 4256 | 1387 | ATLKMKQGPMTQAVSYLPRMCLQYPS |
Top |
Potential FusionNeoAntigen Information of AKAP13-SPI1 in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| AKAP13-SPI1_86129054_47380557.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B35:01 | GPMTQAVSY | 0.9961 | 0.58 | 7 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B35:08 | GPMTQAVSY | 0.9896 | 0.5945 | 7 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B48:01 | KQGPMTQAV | 0.9888 | 0.8509 | 5 | 14 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:02 | GPMTQAVSY | 0.9786 | 0.7272 | 7 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-A02:21 | KQGPMTQAV | 0.9372 | 0.7246 | 5 | 14 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B13:02 | KQGPMTQAV | 0.8861 | 0.9677 | 5 | 14 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B13:01 | KQGPMTQAV | 0.7707 | 0.9857 | 5 | 14 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B39:13 | KQGPMTQAV | 0.6196 | 0.9623 | 5 | 14 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B52:01 | KQGPMTQAV | 0.0419 | 0.9816 | 5 | 14 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B35:08 | QGPMTQAVSY | 0.8805 | 0.6843 | 6 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B35:01 | QGPMTQAVSY | 0.8178 | 0.6797 | 6 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:01 | KQGPMTQAVSY | 1 | 0.5997 | 5 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:25 | KQGPMTQAVSY | 0.9905 | 0.6841 | 5 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B35:08 | KQGPMTQAVSY | 0.8768 | 0.5393 | 5 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-C03:08 | QAVSYLPRM | 0.9987 | 0.7899 | 11 | 20 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-C03:07 | QAVSYLPRM | 0.9986 | 0.9334 | 11 | 20 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-C03:19 | QAVSYLPRM | 0.9985 | 0.9715 | 11 | 20 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-C15:04 | QAVSYLPRM | 0.9984 | 0.8449 | 11 | 20 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:31 | GPMTQAVSY | 0.9957 | 0.542 | 7 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-A02:05 | KQGPMTQAV | 0.9818 | 0.6053 | 5 | 14 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-C12:12 | QAVSYLPRM | 0.9807 | 0.913 | 11 | 20 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:21 | GPMTQAVSY | 0.9785 | 0.6421 | 7 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-C06:03 | QAVSYLPRM | 0.964 | 0.9858 | 11 | 20 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-C12:04 | QAVSYLPRM | 0.9638 | 0.9857 | 11 | 20 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-C03:14 | QAVSYLPRM | 0.8822 | 0.9662 | 11 | 20 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B48:03 | KQGPMTQAV | 0.8673 | 0.7915 | 5 | 14 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:04 | KQGPMTQAV | 0.8142 | 0.9493 | 5 | 14 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B39:08 | KQGPMTQAV | 0.6404 | 0.9359 | 5 | 14 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:31 | QGPMTQAVSY | 0.826 | 0.6616 | 6 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B42:01 | GPMTQAVSYL | 0.6074 | 0.5703 | 7 | 17 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:04 | KQGPMTQAVSY | 0.9948 | 0.6758 | 5 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:05 | KQGPMTQAVSY | 0.9541 | 0.5475 | 5 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B35:11 | PMTQAVSY | 0.9106 | 0.8006 | 8 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B35:24 | PMTQAVSY | 0.8466 | 0.6455 | 8 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-C03:04 | QAVSYLPRM | 0.9985 | 0.971 | 11 | 20 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-C03:02 | QAVSYLPRM | 0.9985 | 0.9525 | 11 | 20 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-C03:03 | QAVSYLPRM | 0.9985 | 0.971 | 11 | 20 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-C15:09 | QAVSYLPRM | 0.9984 | 0.8449 | 11 | 20 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B35:77 | GPMTQAVSY | 0.9961 | 0.58 | 7 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B35:20 | GPMTQAVSY | 0.9954 | 0.67 | 7 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B35:23 | GPMTQAVSY | 0.9954 | 0.6056 | 7 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-C03:05 | QAVSYLPRM | 0.9934 | 0.8373 | 11 | 20 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-C12:02 | QAVSYLPRM | 0.9916 | 0.9454 | 11 | 20 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-C16:04 | QAVSYLPRM | 0.9911 | 0.9658 | 11 | 20 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-C12:03 | QAVSYLPRM | 0.9856 | 0.9692 | 11 | 20 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B40:40 | KQGPMTQAV | 0.9855 | 0.5432 | 5 | 14 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-C16:01 | QAVSYLPRM | 0.9772 | 0.959 | 11 | 20 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B35:11 | GPMTQAVSY | 0.977 | 0.6384 | 7 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B35:24 | GPMTQAVSY | 0.9728 | 0.6054 | 7 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-C16:02 | QAVSYLPRM | 0.9481 | 0.9813 | 11 | 20 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-A02:06 | KQGPMTQAV | 0.9372 | 0.7246 | 5 | 14 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-A02:14 | KQGPMTQAV | 0.9372 | 0.6896 | 5 | 14 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:73 | KQGPMTQAV | 0.925 | 0.9813 | 5 | 14 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B40:12 | KQGPMTQAV | 0.8673 | 0.7915 | 5 | 14 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:30 | KQGPMTQAV | 0.7932 | 0.9744 | 5 | 14 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:13 | GPMTQAVSY | 0.7489 | 0.5127 | 7 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B39:02 | KQGPMTQAV | 0.6743 | 0.9582 | 5 | 14 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B40:21 | KQGPMTQAV | 0.6554 | 0.8039 | 5 | 14 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-C02:10 | QAVSYLPRM | 0.5985 | 0.9223 | 11 | 20 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-C02:02 | QAVSYLPRM | 0.5985 | 0.9223 | 11 | 20 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B18:04 | GPMTQAVSY | 0.4938 | 0.6336 | 7 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:08 | GPMTQAVSY | 0.4034 | 0.5616 | 7 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:11 | GPMTQAVSY | 0.3855 | 0.5597 | 7 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B35:43 | GPMTQAVSY | 0.342 | 0.5702 | 7 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B18:03 | GPMTQAVSY | 0.1606 | 0.6027 | 7 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B18:07 | GPMTQAVSY | 0.1408 | 0.537 | 7 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B18:06 | GPMTQAVSY | 0.1402 | 0.5905 | 7 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B18:08 | GPMTQAVSY | 0.1038 | 0.5817 | 7 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:11 | QGPMTQAVSY | 0.9865 | 0.6197 | 6 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:08 | QGPMTQAVSY | 0.985 | 0.609 | 6 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B35:43 | QGPMTQAVSY | 0.9838 | 0.6155 | 6 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B35:11 | QGPMTQAVSY | 0.9009 | 0.7121 | 6 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B35:77 | QGPMTQAVSY | 0.8178 | 0.6797 | 6 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B35:23 | QGPMTQAVSY | 0.8138 | 0.7077 | 6 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B35:20 | QGPMTQAVSY | 0.8049 | 0.7316 | 6 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B35:24 | QGPMTQAVSY | 0.7713 | 0.6814 | 6 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B67:01 | GPMTQAVSYL | 0.7139 | 0.6176 | 7 | 17 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B35:17 | QGPMTQAVSY | 0.6934 | 0.5543 | 6 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B35:30 | QGPMTQAVSY | 0.6934 | 0.5543 | 6 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B18:07 | QGPMTQAVSY | 0.2397 | 0.6549 | 6 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:33 | KQGPMTQAVSY | 1 | 0.5997 | 5 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:135 | KQGPMTQAVSY | 1 | 0.6459 | 5 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:125 | KQGPMTQAVSY | 1 | 0.5997 | 5 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:34 | KQGPMTQAVSY | 1 | 0.5997 | 5 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:27 | KQGPMTQAVSY | 1 | 0.6405 | 5 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:50 | KQGPMTQAVSY | 0.9999 | 0.609 | 5 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:24 | KQGPMTQAVSY | 0.9998 | 0.7673 | 5 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:53 | KQGPMTQAVSY | 0.9998 | 0.5782 | 5 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:12 | KQGPMTQAVSY | 0.9993 | 0.5908 | 5 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:54 | KQGPMTQAVSY | 0.9986 | 0.5453 | 5 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:35 | KQGPMTQAVSY | 0.9976 | 0.6224 | 5 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:39 | KQGPMTQAVSY | 0.9913 | 0.5602 | 5 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B35:11 | KQGPMTQAVSY | 0.9701 | 0.6266 | 5 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B15:20 | KQGPMTQAVSY | 0.9571 | 0.6141 | 5 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B35:28 | KQGPMTQAVSY | 0.9417 | 0.6202 | 5 | 16 |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 | HLA-B48:02 | KQGPMTQAVSY | 0.7161 | 0.5996 | 5 | 16 |
Top |
Potential FusionNeoAntigen Information of AKAP13-SPI1 in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of AKAP13-SPI1 |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 7284 | QGPMTQAVSYLPRM | AKAP13 | SPI1 | chr15 | 86129054 | chr11 | 47380557 | 4242 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of AKAP13-SPI1 |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 7284 | QGPMTQAVSYLPRM | -5.42908 | -5.54248 |
| HLA-B14:02 | 3BVN | 7284 | QGPMTQAVSYLPRM | -5.06008 | -6.09538 |
| HLA-B52:01 | 3W39 | 7284 | QGPMTQAVSYLPRM | -9.1987 | -9.3121 |
| HLA-B52:01 | 3W39 | 7284 | QGPMTQAVSYLPRM | -7.53083 | -8.56613 |
| HLA-A11:01 | 4UQ2 | 7284 | QGPMTQAVSYLPRM | -8.87547 | -8.98887 |
| HLA-A24:02 | 5HGA | 7284 | QGPMTQAVSYLPRM | -7.78065 | -7.89405 |
| HLA-A24:02 | 5HGA | 7284 | QGPMTQAVSYLPRM | -7.11918 | -8.15448 |
| HLA-B27:05 | 6PYJ | 7284 | QGPMTQAVSYLPRM | -7.64943 | -7.76283 |
| HLA-B27:05 | 6PYJ | 7284 | QGPMTQAVSYLPRM | -6.50173 | -7.53703 |
| HLA-B44:05 | 3DX8 | 7284 | QGPMTQAVSYLPRM | -7.26947 | -7.38287 |
| HLA-B44:05 | 3DX8 | 7284 | QGPMTQAVSYLPRM | -6.09544 | -7.13074 |
Top |
Vaccine Design for the FusionNeoAntigens of AKAP13-SPI1 |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 11 | 20 | QAVSYLPRM | CAGGCGGTCTCCTACCTGCCCCGGATG |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 5 | 14 | KQGPMTQAV | AAGCAAGGCCCAATGACCCAGGCGGTC |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 5 | 16 | KQGPMTQAVSY | AAGCAAGGCCCAATGACCCAGGCGGTCTCCTAC |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 6 | 16 | QGPMTQAVSY | CAAGGCCCAATGACCCAGGCGGTCTCCTAC |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 7 | 16 | GPMTQAVSY | GGCCCAATGACCCAGGCGGTCTCCTAC |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 7 | 17 | GPMTQAVSYL | GGCCCAATGACCCAGGCGGTCTCCTACCTG |
| AKAP13-SPI1 | chr15 | 86129054 | chr11 | 47380557 | 8 | 16 | PMTQAVSY | CCAATGACCCAGGCGGTCTCCTAC |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of AKAP13-SPI1 |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| OV | AKAP13-SPI1 | chr15 | 86129054 | ENST00000361243 | chr11 | 47380557 | ENST00000227163 | TCGA-30-1866 |
Top |
Potential target of CAR-T therapy development for AKAP13-SPI1 |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to AKAP13-SPI1 |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to AKAP13-SPI1 |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies