Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:GLO1-UBR2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: GLO1-UBR2
	FusionPDB ID: 33328
	FusionGDB2.0 ID: 33328
		Hgene	Tgene
	Gene symbol	GLO1	UBR2
	Gene ID	2739	23304
	Gene name	glyoxalase I	ubiquitin protein ligase E3 component n-recognin 2
	Synonyms	GLOD1\|GLYI\|HEL-S-74	C6orf133\|bA49A4.1\|dJ242G1.1\|dJ392M17.3
	Cytomap	6p21.2	6p21.1
	Type of gene	protein-coding	protein-coding
	Description	lactoylglutathione lyaseS-D-lactoylglutathione methylglyoxal lyasealdoketomutaseepididymis secretory protein Li 74glx Iglyoxalase domain containing 1ketone-aldehyde mutaselactoyl glutathione lyasemethylglyoxalase	E3 ubiquitin-protein ligase UBR2RING-type E3 ubiquitin transferase UBR2ubiquitin-protein ligase E3-alpha-2ubiquitin-protein ligase E3-alpha-II
	Modification date	20200315	20200313
	UniProtAcc	Q04760 Main function of 5'-partner protein: FUNCTION: Catalyzes the conversion of hemimercaptal, formed from methylglyoxal and glutathione, to S-lactoylglutathione. Involved in the regulation of TNF-induced transcriptional activity of NF-kappa-B. Required for normal osteoclastogenesis. {ECO:0000269\|PubMed:19199007, ECO:0000269\|PubMed:23122816, ECO:0000269\|PubMed:9705294}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000373365, ENST00000470973,	ENST00000372883, ENST00000372903, ENST00000372899, ENST00000372901,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	5 X 4 X 4=80	11 X 14 X 8=1232
	# samples	6	15
	** MAII score	log2(6/80*10)=-0.415037499278844 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(15/1232*10)=-3.03796785019902 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: GLO1 [Title/Abstract] AND UBR2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: GLO1 [Title/Abstract] AND UBR2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	GLO1(38670747)-UBR2(42571326), # samples:1
Anticipated loss of major functional domain due to fusion event.	GLO1-UBR2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. GLO1-UBR2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. GLO1-UBR2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. GLO1-UBR2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	GLO1	GO:0043066	negative regulation of apoptotic process	11489834
Tgene	UBR2	GO:0071233	cellular response to leucine	20298436

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr6:38670747/chr6:42571326)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across GLO1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across UBR2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst

Tenst

Hgene

Hchr

Hbp

Hstrand

Tgene

Tchr

Tbp

Tstrand

Seq length
(transcript)

BP loci
(transcript)

Predicted start
(transcript)

Predicted stop
(transcript)

Seq length
(amino acids)

ENST00000373365

GLO1

chr6

38670747

ENST00000372899

UBR2

chr6

42571326

7239

171

4907

1606

ENST00000373365

GLO1

chr6

38670747

ENST00000372901

UBR2

chr6

42571326

7239

171

4907

1606

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000373365	ENST00000372899	GLO1	chr6	38670747	-	UBR2	chr6	42571326	+	0.000114745	0.9998852
ENST00000373365	ENST00000372901	GLO1	chr6	38670747	-	UBR2	chr6	42571326	+	0.000111692	0.9998883

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for GLO1-UBR2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
GLO1	chr6	38670747	UBR2	chr6	42571326	171	28	ALSCCSDADPSTKDPLVHLSEDVIAR

Top

Potential FusionNeoAntigen Information of GLO1-UBR2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

GLO1-UBR2_38670747_42571326.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-B39:13	TKDPLVHL	0.9996	0.9086	11	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-B15:17	STKDPLVHL	0.9957	0.85	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-B15:16	STKDPLVHL	0.9944	0.6773	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-A30:08	STKDPLVHL	0.9888	0.6505	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-B58:02	STKDPLVHL	0.9847	0.7966	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-B57:03	STKDPLVHL	0.974	0.9551	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-A32:13	STKDPLVHL	0.6829	0.9025	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-A02:21	STKDPLVHL	0.5781	0.7152	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-B39:09	TKDPLVHL	0.9998	0.6366	11	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-B39:05	TKDPLVHL	0.9995	0.8811	11	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-B39:08	TKDPLVHL	0.8806	0.84	11	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C15:04	STKDPLVHL	0.9997	0.8326	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C15:06	STKDPLVHL	0.9997	0.8687	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C03:07	STKDPLVHL	0.9995	0.9451	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C03:08	STKDPLVHL	0.9994	0.8942	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C03:19	STKDPLVHL	0.9994	0.9831	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C06:03	STKDPLVHL	0.9984	0.985	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C12:04	STKDPLVHL	0.9982	0.9857	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C12:12	STKDPLVHL	0.9974	0.8548	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C04:06	STKDPLVHL	0.9953	0.8618	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C12:16	STKDPLVHL	0.9949	0.9459	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C04:14	STKDPLVHL	0.9947	0.8571	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-B15:04	STKDPLVHL	0.9911	0.8899	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C08:13	STKDPLVHL	0.9883	0.9181	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C08:04	STKDPLVHL	0.9883	0.9181	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C07:05	STKDPLVHL	0.9672	0.9455	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C03:14	STKDPLVHL	0.963	0.9517	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C07:10	STKDPLVHL	0.9508	0.9369	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C07:27	STKDPLVHL	0.9291	0.9539	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C01:17	STKDPLVHL	0.9228	0.8962	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C07:95	STKDPLVHL	0.9203	0.7072	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C07:19	STKDPLVHL	0.9202	0.7447	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C01:30	STKDPLVHL	0.9202	0.9449	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C02:06	STKDPLVHL	0.9164	0.9248	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C07:13	STKDPLVHL	0.9054	0.9334	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C07:29	STKDPLVHL	0.8895	0.9417	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C08:03	STKDPLVHL	0.8639	0.9668	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-B39:10	DPSTKDPLVHL	0.7612	0.7761	8	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C18:01	TKDPLVHL	1	0.8618	11	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-B39:02	TKDPLVHL	0.9998	0.9086	11	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-B39:11	TKDPLVHL	0.949	0.7698	11	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C15:09	STKDPLVHL	0.9997	0.8326	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C15:05	STKDPLVHL	0.9996	0.8327	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C15:02	STKDPLVHL	0.9996	0.8242	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C03:03	STKDPLVHL	0.9993	0.9829	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C03:04	STKDPLVHL	0.9993	0.9829	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C03:17	STKDPLVHL	0.9991	0.9609	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C03:05	STKDPLVHL	0.9986	0.9475	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C16:04	STKDPLVHL	0.9986	0.9612	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C06:02	STKDPLVHL	0.9982	0.9851	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C06:17	STKDPLVHL	0.9982	0.9851	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C03:67	STKDPLVHL	0.998	0.9715	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C12:03	STKDPLVHL	0.9979	0.9493	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C06:06	STKDPLVHL	0.9975	0.9874	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C03:02	STKDPLVHL	0.9975	0.9555	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-B58:06	STKDPLVHL	0.9951	0.6636	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C12:02	STKDPLVHL	0.9946	0.9497	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C04:04	STKDPLVHL	0.994	0.8633	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C16:02	STKDPLVHL	0.9911	0.9885	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-B57:02	STKDPLVHL	0.9907	0.7906	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-A30:01	STKDPLVHL	0.9897	0.785	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C07:04	STKDPLVHL	0.9865	0.9393	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C03:06	STKDPLVHL	0.9854	0.9816	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-B15:73	STKDPLVHL	0.9774	0.8369	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C01:03	STKDPLVHL	0.9742	0.846	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-B15:30	STKDPLVHL	0.9679	0.7401	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C07:22	STKDPLVHL	0.962	0.6938	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-A32:01	STKDPLVHL	0.943	0.8979	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-A02:03	STKDPLVHL	0.9392	0.5473	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-A25:01	STKDPLVHL	0.9389	0.8303	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-A69:01	STKDPLVHL	0.9381	0.6601	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C16:01	STKDPLVHL	0.9311	0.972	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C07:01	STKDPLVHL	0.9298	0.7116	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C01:02	STKDPLVHL	0.9297	0.8884	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C08:01	STKDPLVHL	0.8639	0.9668	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C02:10	STKDPLVHL	0.8308	0.9539	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C02:02	STKDPLVHL	0.8308	0.9539	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C06:08	STKDPLVHL	0.7834	0.9704	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-B07:13	STKDPLVHL	0.6138	0.7193	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-A02:14	STKDPLVHL	0.5887	0.5687	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-A02:06	STKDPLVHL	0.5781	0.7152	10	19
GLO1-UBR2	chr6	38670747	chr6	42571326	171	HLA-C17:01	STKDPLVHL	0.5425	0.742	10	19

Top

Potential FusionNeoAntigen Information of GLO1-UBR2 in HLA II

GLO1-UBR2_38670747_42571326.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
GLO1-UBR2	chr6	38670747	chr6	42571326	171	DRB1-1203	TKDPLVHLSEDVIAR	11	26
GLO1-UBR2	chr6	38670747	chr6	42571326	171	DRB1-1219	TKDPLVHLSEDVIAR	11	26
GLO1-UBR2	chr6	38670747	chr6	42571326	171	DRB1-1220	TKDPLVHLSEDVIAR	11	26
GLO1-UBR2	chr6	38670747	chr6	42571326	171	DRB1-1221	TKDPLVHLSEDVIAR	11	26
GLO1-UBR2	chr6	38670747	chr6	42571326	171	DRB1-1503	TKDPLVHLSEDVIAR	11	26
GLO1-UBR2	chr6	38670747	chr6	42571326	171	DRB1-1523	TKDPLVHLSEDVIAR	11	26

Top

Fusion breakpoint peptide structures of GLO1-UBR2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
984	DADPSTKDPLVHLS	GLO1	UBR2	chr6	38670747	chr6	42571326	171

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of GLO1-UBR2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	984	DADPSTKDPLVHLS	-4.32496	-4.43836
HLA-B14:02	3BVN	984	DADPSTKDPLVHLS	-4.28636	-5.32166
HLA-B52:01	3W39	984	DADPSTKDPLVHLS	-4.99247	-5.10587
HLA-B52:01	3W39	984	DADPSTKDPLVHLS	-3.12246	-4.15776
HLA-A24:02	5HGA	984	DADPSTKDPLVHLS	-7.1879	-7.3013
HLA-A24:02	5HGA	984	DADPSTKDPLVHLS	-2.87243	-3.90773
HLA-B44:05	3DX8	984	DADPSTKDPLVHLS	-6.24436	-7.27966
HLA-B44:05	3DX8	984	DADPSTKDPLVHLS	-5.84868	-5.96208

Top

Vaccine Design for the FusionNeoAntigens of GLO1-UBR2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
GLO1-UBR2	chr6	38670747	chr6	42571326	10	19	STKDPLVHL	AGTACCAAGGATCCTCTTGTTCATTTA
GLO1-UBR2	chr6	38670747	chr6	42571326	11	19	TKDPLVHL	ACCAAGGATCCTCTTGTTCATTTA
GLO1-UBR2	chr6	38670747	chr6	42571326	8	19	DPSTKDPLVHL	GACCCCAGTACCAAGGATCCTCTTGTTCATTTA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
GLO1-UBR2	chr6	38670747	chr6	42571326	11	26	TKDPLVHLSEDVIAR	ACCAAGGATCCTCTTGTTCATTTATCAGAAGATGTGATAGCAAGA

Top

Information of the samples that have these potential fusion neoantigens of GLO1-UBR2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
SARC	GLO1-UBR2	chr6	38670747	ENST00000373365	chr6	42571326	ENST00000372899	TCGA-3B-A9HL-01A

Top

Potential target of CAR-T therapy development for GLO1-UBR2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to GLO1-UBR2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to GLO1-UBR2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)