Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:GNA11-TLE6

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: GNA11-TLE6
	FusionPDB ID: 33521
	FusionGDB2.0 ID: 33521
		Hgene	Tgene
	Gene symbol	GNA11	TLE6
	Gene ID	2767	79816
	Gene name	G protein subunit alpha 11	TLE family member 6, subcortical maternal complex member
	Synonyms	FBH\|FBH2\|FHH2\|GNA-11\|HHC2\|HYPOC2	GRG6\|PREMBL
	Cytomap	19p13.3	19p13.3
	Type of gene	protein-coding	protein-coding
	Description	guanine nucleotide-binding protein subunit alpha-11g alpha-11guanine nucleotide binding protein (G protein), alpha 11 (Gq class)guanine nucleotide-binding protein G(y) subunit alpha	transducin-like enhancer protein 6transducin like enhancer of split 6transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila)
	Modification date	20200313	20200313
	UniProtAcc	P29992 Main function of 5'-partner protein: FUNCTION: Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling systems. Acts as an activator of phospholipase C. Transduces FFAR4 signaling in response to long-chain fatty acids (LCFAs). {ECO:0000269\|PubMed:27852822}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000078429, ENST00000586180,	ENST00000452088, ENST00000478073, ENST00000482627, ENST00000246112,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	8 X 4 X 5=160	5 X 5 X 5=125
	# samples	12	7
	** MAII score	log2(12/160*10)=-0.415037499278844 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(7/125*10)=-0.836501267717121 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: GNA11 [Title/Abstract] AND TLE6 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: GNA11 [Title/Abstract] AND TLE6 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	GNA11(3113482)-TLE6(2991841), # samples:1
Anticipated loss of major functional domain due to fusion event.	GNA11-TLE6 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. GNA11-TLE6 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. GNA11-TLE6 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. GNA11-TLE6 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:3113482/chr19:2991841)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across GNA11 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across TLE6 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst

Tenst

Hgene

Hchr

Hbp

Hstrand

Tgene

Tchr

Tbp

Tstrand

Seq length
(transcript)

BP loci
(transcript)

Predicted start
(transcript)

Predicted stop
(transcript)

Seq length
(amino acids)

ENST00000078429

GNA11

chr19

3113482

ENST00000246112

TLE6

chr19

2991841

1368

718

1180

393

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000078429	ENST00000246112	GNA11	chr19	3113482	+	TLE6	chr19	2991841	+	0.00279162	0.9972084

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for GNA11-TLE6

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
GNA11	chr19	3113482	TLE6	chr19	2991841	718	218	GLVLLVLVEDLERLHGPDHGLHGGED
GNA11	chr19	3113482	TLE6	chr19	2991841	718	314	AQATRHHGLQSHRPGPGRRGRLPAAA

Top

Potential FusionNeoAntigen Information of GNA11-TLE6 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

GNA11-TLE6_3113482_2991841.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:67	VLVEDLERL	0.9968	0.6454	5	14
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:30	VLVEDLERL	0.9968	0.6454	5	14
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:24	VLVEDLERL	0.9968	0.6454	5	14
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:60	VLVEDLERL	0.9967	0.6144	5	14
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:11	VLVEDLERL	0.9962	0.6877	5	14
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:21	VLVEDLERL	0.9948	0.7634	5	14
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:16	VLVEDLERL	0.993	0.5287	5	14
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:27	VLVEDLERL	0.993	0.5523	5	14
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:04	VLVEDLERL	0.9893	0.584	5	14
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:13	VLVEDLERL	0.9885	0.7021	5	14
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:38	VLVEDLERL	0.9843	0.6347	5	14
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:22	RLHGPDHGL	0.964	0.6542	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:13	RLHGPDHGL	0.9536	0.7983	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:35	VLVEDLERL	0.9398	0.6656	5	14
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:27	RLHGPDHGL	0.9291	0.7214	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:29	VLVEDLERL	0.9186	0.6419	5	14
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:38	RLHGPDHGL	0.918	0.8078	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:20	VLVEDLERL	0.8953	0.654	5	14
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:11	RLHGPDHGL	0.8897	0.6538	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:67	RLHGPDHGL	0.8807	0.6345	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:24	RLHGPDHGL	0.8807	0.6345	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:30	RLHGPDHGL	0.8807	0.6345	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:60	RLHGPDHGL	0.8802	0.6236	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:04	RLHGPDHGL	0.8591	0.6389	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-B07:10	RLHGPDHGL	0.8546	0.6006	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:16	RLHGPDHGL	0.8521	0.587	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:17	RLHGPDHGL	0.8441	0.6066	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:29	RLHGPDHGL	0.7738	0.6377	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:35	RLHGPDHGL	0.7617	0.6635	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:20	RLHGPDHGL	0.7214	0.6396	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:19	RLHGPDHGL	0.6929	0.6431	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-B48:01	RLHGPDHGL	0.1644	0.729	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-B13:01	RLHGPDHGL	0.0477	0.9698	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-B13:01	VLVEDLERL	0.0393	0.9465	5	14
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-B13:02	RLHGPDHGL	0.024	0.7053	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-B38:02	ERLHGPDHGL	0.9788	0.9664	11	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:22	LVLVEDLERL	0.8522	0.6074	4	14
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:01	VLVEDLERL	0.9968	0.6454	5	14
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:07	VLVEDLERL	0.9966	0.6284	5	14
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:05	RLHGPDHGL	0.9576	0.5578	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:01	RLHGPDHGL	0.8807	0.6345	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-B15:04	RLHGPDHGL	0.8483	0.9715	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-B39:08	RLHGPDHGL	0.1894	0.9796	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-B48:03	RLHGPDHGL	0.0254	0.5268	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-B39:12	ERLHGPDHGL	0.9875	0.8819	11	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:06	VLVEDLERL	0.9948	0.7634	5	14
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:14	VLVEDLERL	0.9947	0.6921	5	14
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:03	VLVEDLERL	0.9939	0.6652	5	14
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:03	RLHGPDHGL	0.9812	0.7246	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A32:01	RLHGPDHGL	0.9308	0.9836	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-B15:73	RLHGPDHGL	0.8818	0.7888	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-A02:14	RLHGPDHGL	0.8209	0.6505	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-B15:73	VLVEDLERL	0.8106	0.888	5	14
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-B15:30	RLHGPDHGL	0.6835	0.9231	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-B15:30	VLVEDLERL	0.625	0.9197	5	14
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-B39:02	RLHGPDHGL	0.066	0.959	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-B40:21	RLHGPDHGL	0.0258	0.6737	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-B40:12	RLHGPDHGL	0.0254	0.5268	12	21
GNA11-TLE6	chr19	3113482	chr19	2991841	718	HLA-B39:31	ERLHGPDHGL	0.99	0.8771	11	21

Top

Potential FusionNeoAntigen Information of GNA11-TLE6 in HLA II

GNA11-TLE6_3113482_2991841.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-0804	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-0820	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-0831	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1104	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1104	LLVLVEDLERLHGPD	3	18
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1106	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1118	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1125	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1135	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1135	LLVLVEDLERLHGPD	3	18
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1138	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1138	LLVLVEDLERLHGPD	3	18
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1142	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1143	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1143	LLVLVEDLERLHGPD	3	18
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1144	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1144	LLVLVEDLERLHGPD	3	18
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1146	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1146	LLVLVEDLERLHGPD	3	18
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1147	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1150	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1156	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1157	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1158	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1158	LLVLVEDLERLHGPD	3	18
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1160	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1160	LLVLVEDLERLHGPD	3	18
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1177	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1177	LLVLVEDLERLHGPD	3	18
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1178	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1178	LLVLVEDLERLHGPD	3	18
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1183	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1184	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1188	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1192	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1306	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1311	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1311	LLVLVEDLERLHGPD	3	18
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1318	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1342	LVLVEDLERLHGPDH	4	19
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1342	LLVLVEDLERLHGPD	3	18
GNA11-TLE6	chr19	3113482	chr19	2991841	718	DRB1-1415	LVLVEDLERLHGPDH	4	19

Top

Fusion breakpoint peptide structures of GNA11-TLE6

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
5767	LVEDLERLHGPDHG	GNA11	TLE6	chr19	3113482	chr19	2991841	718

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of GNA11-TLE6

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	5767	LVEDLERLHGPDHG	-6.35597	-6.46937
HLA-B14:02	3BVN	5767	LVEDLERLHGPDHG	-5.80319	-6.83849
HLA-B52:01	3W39	5767	LVEDLERLHGPDHG	-6.67268	-6.78608
HLA-B52:01	3W39	5767	LVEDLERLHGPDHG	-5.72753	-6.76283
HLA-A11:01	4UQ2	5767	LVEDLERLHGPDHG	-7.31441	-7.42781
HLA-A11:01	4UQ2	5767	LVEDLERLHGPDHG	-7.25126	-8.28656
HLA-A24:02	5HGA	5767	LVEDLERLHGPDHG	-8.41244	-8.52584
HLA-A24:02	5HGA	5767	LVEDLERLHGPDHG	-5.27978	-6.31508
HLA-B44:05	3DX8	5767	LVEDLERLHGPDHG	-4.03348	-4.14688
HLA-B44:05	3DX8	5767	LVEDLERLHGPDHG	-3.56413	-4.59943
HLA-A02:01	6TDR	5767	LVEDLERLHGPDHG	-6.72173	-7.75703

Top

Vaccine Design for the FusionNeoAntigens of GNA11-TLE6

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
GNA11-TLE6	chr19	3113482	chr19	2991841	11	21	ERLHGPDHGL	CAAGTAGGACCTCAAGGGTTATCCTGATGG
GNA11-TLE6	chr19	3113482	chr19	2991841	12	21	RLHGPDHGL	GTAGGACCTCAAGGGTTATCCTGATGG
GNA11-TLE6	chr19	3113482	chr19	2991841	4	14	LVLVEDLERL	GTACCAGCTCTCCGACTCTGCCAAGTAGGA
GNA11-TLE6	chr19	3113482	chr19	2991841	5	14	VLVEDLERL	CCAGCTCTCCGACTCTGCCAAGTAGGA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
GNA11-TLE6	chr19	3113482	chr19	2991841	3	18	LLVLVEDLERLHGPD	CGAGTACCAGCTCTCCGACTCTGCCAAGTAGGACCTCAAGGGTTA
GNA11-TLE6	chr19	3113482	chr19	2991841	4	19	LVLVEDLERLHGPDH	GTACCAGCTCTCCGACTCTGCCAAGTAGGACCTCAAGGGTTATCC

Top

Information of the samples that have these potential fusion neoantigens of GNA11-TLE6

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	GNA11-TLE6	chr19	3113482	ENST00000078429	chr19	2991841	ENST00000246112	TCGA-BR-8295-01A

Top

Potential target of CAR-T therapy development for GNA11-TLE6

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to GNA11-TLE6

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to GNA11-TLE6

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)