Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:AKAP6-PRKD1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: AKAP6-PRKD1
	FusionPDB ID: 3353
	FusionGDB2.0 ID: 3353
		Hgene	Tgene
	Gene symbol	AKAP6	PRKD1
	Gene ID	9472	5587
	Gene name	A-kinase anchoring protein 6	protein kinase D1
	Synonyms	ADAP100\|ADAP6\|AKAP100\|PRKA6\|mAKAP	CHDED\|PKC-MU\|PKCM\|PKD\|PRKCM
	Cytomap	14q12	14q12
	Type of gene	protein-coding	protein-coding
	Description	A-kinase anchor protein 6A kinase (PRKA) anchor protein 6A-kinase anchor protein 100 kDaAKAP 100AKAP-6protein kinase A anchoring protein 6	serine/threonine-protein kinase D1nPKC-D1nPKC-muprotein kinase C mu typeprotein kinase C, muprotein kinase D
	Modification date	20200313	20200315
	UniProtAcc	Q13023 Main function of 5'-partner protein: FUNCTION: Binds to type II regulatory subunits of protein kinase A and anchors/targets them to the nuclear membrane or sarcoplasmic reticulum. May act as an adapter for assembling multiprotein complexes.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000280979, ENST00000557272, ENST00000557354, ENST00000554449,	ENST00000551644, ENST00000331968, ENST00000415220,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	9 X 8 X 4=288	14 X 13 X 7=1274
	# samples	9	13
	** MAII score	log2(9/288*10)=-1.67807190511264 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(13/1274*10)=-3.29278174922785 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: AKAP6 [Title/Abstract] AND PRKD1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: AKAP6 [Title/Abstract] AND PRKD1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	AKAP6(33069998)-PRKD1(30095762), # samples:3
Anticipated loss of major functional domain due to fusion event.	AKAP6-PRKD1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. AKAP6-PRKD1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. AKAP6-PRKD1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. AKAP6-PRKD1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	AKAP6	GO:0060306	regulation of membrane repolarization	11299204
Hgene	AKAP6	GO:0071320	cellular response to cAMP	11299204
Hgene	AKAP6	GO:1901381	positive regulation of potassium ion transmembrane transport	11299204
Hgene	AKAP6	GO:1902261	positive regulation of delayed rectifier potassium channel activity	11299204
Tgene	PRKD1	GO:0006468	protein phosphorylation	24623306
Tgene	PRKD1	GO:0018105	peptidyl-serine phosphorylation	18440775
Tgene	PRKD1	GO:0018107	peptidyl-threonine phosphorylation	22095288
Tgene	PRKD1	GO:0034599	cellular response to oxidative stress	12505989
Tgene	PRKD1	GO:0046777	protein autophosphorylation	24623306

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr14:33069998/chr14:30095762)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across AKAP6 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across PRKD1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000280979	AKAP6	chr14	33069998	+	ENST00000331968	PRKD1	chr14	30095762	-	4671	2900	170	3913	1247
ENST00000280979	AKAP6	chr14	33069998	+	ENST00000415220	PRKD1	chr14	30095762	-	4210	2900	170	3913	1247
ENST00000557354	AKAP6	chr14	33069998	+	ENST00000331968	PRKD1	chr14	30095762	-	4600	2829	99	3842	1247
ENST00000557354	AKAP6	chr14	33069998	+	ENST00000415220	PRKD1	chr14	30095762	-	4139	2829	99	3842	1247
ENST00000557272	AKAP6	chr14	33069998	+	ENST00000331968	PRKD1	chr14	30095762	-	4544	2773	43	3786	1247
ENST00000557272	AKAP6	chr14	33069998	+	ENST00000415220	PRKD1	chr14	30095762	-	4083	2773	43	3786	1247

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000280979	ENST00000331968	AKAP6	chr14	33069998	+	PRKD1	chr14	30095762	-	0.001151383	0.99884856
ENST00000280979	ENST00000415220	AKAP6	chr14	33069998	+	PRKD1	chr14	30095762	-	0.001757452	0.9982425
ENST00000557354	ENST00000331968	AKAP6	chr14	33069998	+	PRKD1	chr14	30095762	-	0.001000194	0.9989998
ENST00000557354	ENST00000415220	AKAP6	chr14	33069998	+	PRKD1	chr14	30095762	-	0.001506565	0.99849343
ENST00000557272	ENST00000331968	AKAP6	chr14	33069998	+	PRKD1	chr14	30095762	-	0.000945038	0.99905497
ENST00000557272	ENST00000415220	AKAP6	chr14	33069998	+	PRKD1	chr14	30095762	-	0.001434421	0.9985656

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for AKAP6-PRKD1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
AKAP6	chr14	33069998	PRKD1	chr14	30095762	2773	910	VSVEDEEGTGSPKDISTVYQIFPDEV
AKAP6	chr14	33069998	PRKD1	chr14	30095762	2829	910	VSVEDEEGTGSPKDISTVYQIFPDEV
AKAP6	chr14	33069998	PRKD1	chr14	30095762	2900	910	VSVEDEEGTGSPKDISTVYQIFPDEV

Top

Potential FusionNeoAntigen Information of AKAP6-PRKD1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

AKAP6-PRKD1_33069998_30095762.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:01	SPKDISTVY	0.9947	0.63	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:02	SPKDISTVY	0.9617	0.7254	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B13:01	KDISTVYQI	0.92	0.8159	12	21
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:25	SPKDISTVY	0.8836	0.7195	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:03	SPKDISTVY	0.7032	0.7062	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B52:01	KDISTVYQI	0.3189	0.7803	12	21
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:04	SPKDISTVY	0.2474	0.7143	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:02	SPKDISTVY	0.2474	0.7143	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B18:01	SPKDISTVY	0.1439	0.7669	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:01	GSPKDISTVY	0.9908	0.7863	9	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:25	GSPKDISTVY	0.9791	0.7814	9	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:02	GSPKDISTVY	0.9472	0.7916	9	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:08	GSPKDISTVY	0.9161	0.7352	9	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:01	GSPKDISTVY	0.848	0.7509	9	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:08	TGSPKDISTVY	0.9976	0.7953	8	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:02	TGSPKDISTVY	0.9958	0.8531	8	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:01	TGSPKDISTVY	0.9948	0.8012	8	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:05	TGSPKDISTVY	0.9932	0.5403	8	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B39:10	SPKDISTV	0.6331	0.651	10	18
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:31	SPKDISTVY	0.9941	0.597	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:05	SPKDISTVY	0.9764	0.5822	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:21	SPKDISTVY	0.9625	0.6869	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-C01:17	GSPKDISTV	0.7633	0.9526	9	18
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-C07:19	SPKDISTVY	0.2918	0.5226	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:12	SPKDISTVY	0.2474	0.7143	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-C07:80	SPKDISTVY	0.2385	0.8386	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-C07:67	SPKDISTVY	0.2385	0.8386	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-C07:10	SPKDISTVY	0.2052	0.8511	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-C07:27	SPKDISTVY	0.1948	0.8765	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-C12:16	SPKDISTVY	0.1646	0.8829	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-C03:14	SPKDISTVY	0.0503	0.9129	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B39:10	SPKDISTVY	0.0222	0.6656	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-C12:12	SPKDISTVY	0.0045	0.797	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:07	GSPKDISTVY	0.978	0.5291	9	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:31	GSPKDISTVY	0.8502	0.7171	9	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:31	TGSPKDISTVY	0.9954	0.786	8	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:11	PKDISTVY	0.9407	0.6987	11	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:24	PKDISTVY	0.9394	0.7491	11	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:11	PKDISTVY	0.8408	0.6643	11	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:08	PKDISTVY	0.827	0.6484	11	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:43	PKDISTVY	0.8071	0.6469	11	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B18:07	PKDISTVY	0.7488	0.6956	11	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:77	SPKDISTVY	0.9947	0.63	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:23	SPKDISTVY	0.9942	0.5778	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:20	SPKDISTVY	0.9925	0.6682	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:20	SPKDISTVY	0.979	0.6677	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:28	SPKDISTVY	0.9584	0.6628	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:11	SPKDISTVY	0.9581	0.6746	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:24	SPKDISTVY	0.9358	0.7574	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:39	SPKDISTVY	0.8834	0.5995	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-C01:03	GSPKDISTV	0.8532	0.9212	9	18
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-C01:02	GSPKDISTV	0.8024	0.9521	9	18
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B48:02	SPKDISTVY	0.7089	0.6362	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B18:11	SPKDISTVY	0.698	0.6996	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B18:04	SPKDISTVY	0.5789	0.7985	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:11	SPKDISTVY	0.539	0.6719	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:08	SPKDISTVY	0.538	0.6571	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:43	SPKDISTVY	0.4921	0.6601	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:12	SPKDISTVY	0.4478	0.775	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:50	SPKDISTVY	0.4376	0.7212	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-C03:02	SPKDISTVY	0.3917	0.9099	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-C07:17	SPKDISTVY	0.3268	0.8992	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:09	SPKDISTVY	0.2474	0.7143	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-C07:02	SPKDISTVY	0.2385	0.8386	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B18:03	SPKDISTVY	0.1622	0.7607	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B18:07	SPKDISTVY	0.1616	0.7134	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B18:06	SPKDISTVY	0.1497	0.7675	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B18:05	SPKDISTVY	0.1439	0.7669	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-A25:01	SPKDISTVY	0.1399	0.5614	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B18:08	SPKDISTVY	0.1281	0.6324	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:53	SPKDISTVY	0.0792	0.6724	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-C12:02	SPKDISTVY	0.0773	0.8864	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:54	SPKDISTVY	0.0381	0.6532	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-C16:04	SPKDISTVY	0.012	0.9121	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-C12:03	SPKDISTVY	0.0047	0.9188	10	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:125	GSPKDISTVY	0.9908	0.7863	9	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:33	GSPKDISTVY	0.9908	0.7863	9	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:34	GSPKDISTVY	0.9908	0.7863	9	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:27	GSPKDISTVY	0.9904	0.7931	9	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:135	GSPKDISTVY	0.9892	0.8128	9	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:11	GSPKDISTVY	0.9863	0.7125	9	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:50	GSPKDISTVY	0.9843	0.8439	9	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:08	GSPKDISTVY	0.9838	0.7084	9	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:43	GSPKDISTVY	0.981	0.7157	9	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:35	GSPKDISTVY	0.9799	0.7803	9	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:39	GSPKDISTVY	0.9791	0.6291	9	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:12	GSPKDISTVY	0.9626	0.8347	9	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:11	GSPKDISTVY	0.955	0.7452	9	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:11	SPKDISTVYQ	0.9371	0.7121	10	20
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:08	SPKDISTVYQ	0.9349	0.6958	10	20
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:43	SPKDISTVYQ	0.9293	0.6959	10	20
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:77	GSPKDISTVY	0.848	0.7509	9	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:23	GSPKDISTVY	0.839	0.703	9	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:20	GSPKDISTVY	0.8289	0.8081	9	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:30	GSPKDISTVY	0.7922	0.5201	9	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:17	GSPKDISTVY	0.7922	0.5201	9	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:11	SPKDISTVYQ	0.7338	0.7257	10	20
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:24	GSPKDISTVY	0.5685	0.8075	9	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B18:07	GSPKDISTVY	0.2285	0.7596	9	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:11	TGSPKDISTVY	0.9983	0.7708	8	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B15:08	TGSPKDISTVY	0.9981	0.7587	8	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:43	TGSPKDISTVY	0.9977	0.7676	8	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:11	TGSPKDISTVY	0.9961	0.7939	8	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:20	TGSPKDISTVY	0.9951	0.8526	8	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:23	TGSPKDISTVY	0.995	0.7997	8	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:77	TGSPKDISTVY	0.9948	0.8012	8	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:17	TGSPKDISTVY	0.9931	0.6725	8	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:30	TGSPKDISTVY	0.9931	0.6725	8	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B35:24	TGSPKDISTVY	0.9591	0.8276	8	19
AKAP6-PRKD1	chr14	33069998	chr14	30095762	2900	HLA-B18:07	TGSPKDISTVY	0.7155	0.7709	8	19

Top

Potential FusionNeoAntigen Information of AKAP6-PRKD1 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of AKAP6-PRKD1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
1755	EGTGSPKDISTVYQ	AKAP6	PRKD1	chr14	33069998	chr14	30095762	2900

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of AKAP6-PRKD1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	1755	EGTGSPKDISTVYQ	-6.82873	-6.94213
HLA-B14:02	3BVN	1755	EGTGSPKDISTVYQ	-3.95422	-4.98952
HLA-B52:01	3W39	1755	EGTGSPKDISTVYQ	-6.77281	-6.88621
HLA-B52:01	3W39	1755	EGTGSPKDISTVYQ	-5.0023	-6.0376
HLA-A11:01	4UQ2	1755	EGTGSPKDISTVYQ	-5.97553	-6.08893
HLA-A24:02	5HGA	1755	EGTGSPKDISTVYQ	-5.43204	-5.54544
HLA-A24:02	5HGA	1755	EGTGSPKDISTVYQ	-5.01709	-6.05239
HLA-B44:05	3DX8	1755	EGTGSPKDISTVYQ	-6.52636	-6.63976
HLA-B44:05	3DX8	1755	EGTGSPKDISTVYQ	-5.28092	-6.31622
HLA-A02:01	6TDR	1755	EGTGSPKDISTVYQ	-6.5349	-7.5702

Top

Vaccine Design for the FusionNeoAntigens of AKAP6-PRKD1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
AKAP6-PRKD1	chr14	33069998	chr14	30095762	10	18	SPKDISTV	AGCCCCAAGGACATCAGCACAGTA
AKAP6-PRKD1	chr14	33069998	chr14	30095762	10	19	SPKDISTVY	AGCCCCAAGGACATCAGCACAGTATAT
AKAP6-PRKD1	chr14	33069998	chr14	30095762	10	20	SPKDISTVYQ	AGCCCCAAGGACATCAGCACAGTATATCAG
AKAP6-PRKD1	chr14	33069998	chr14	30095762	11	19	PKDISTVY	CCCAAGGACATCAGCACAGTATAT
AKAP6-PRKD1	chr14	33069998	chr14	30095762	12	21	KDISTVYQI	AAGGACATCAGCACAGTATATCAGATT
AKAP6-PRKD1	chr14	33069998	chr14	30095762	8	19	TGSPKDISTVY	ACTGGAAGCCCCAAGGACATCAGCACAGTATAT
AKAP6-PRKD1	chr14	33069998	chr14	30095762	9	18	GSPKDISTV	GGAAGCCCCAAGGACATCAGCACAGTA
AKAP6-PRKD1	chr14	33069998	chr14	30095762	9	19	GSPKDISTVY	GGAAGCCCCAAGGACATCAGCACAGTATAT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of AKAP6-PRKD1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
SKCM	AKAP6-PRKD1	chr14	33069998	ENST00000280979	chr14	30095762	ENST00000331968	TCGA-EE-A181-06A

Top

Potential target of CAR-T therapy development for AKAP6-PRKD1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to AKAP6-PRKD1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to AKAP6-PRKD1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)