Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:AKAP7-ESR1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: AKAP7-ESR1
	FusionPDB ID: 3361
	FusionGDB2.0 ID: 3361
		Hgene	Tgene
	Gene symbol	AKAP7	ESR1
	Gene ID	9465	2099
	Gene name	A-kinase anchoring protein 7	estrogen receptor 1
	Synonyms	AKAP15\|AKAP18	ER\|ESR\|ESRA\|ESTRR\|Era\|NR3A1
	Cytomap	6q23.2	6q25.1-q25.2
	Type of gene	protein-coding	protein-coding
	Description	A-kinase anchoring protein 7A kinase (PRKA) anchor protein 7A-kinase anchor protein 18 kDaA-kinase anchor protein 9 kDaAKAP 18	estrogen receptorE2 receptor alphaER-alphaestradiol receptorestrogen nuclear receptor alphaestrogen receptor alpha E1-E2-1-2estrogen receptor alpha E1-N2-E2-1-2nuclear receptor subfamily 3 group A member 1oestrogen receptor alpha
	Modification date	20200313	20200329
	UniProtAcc	Q9P0M2 Main function of 5'-partner protein: FUNCTION: Probably targets cAMP-dependent protein kinase (PKA) to the cellular membrane or cytoskeletal structures. The membrane-associated form reduces epithelial sodium channel (ENaC) activity, whereas the free cytoplasmic form may negatively regulate ENaC channel feedback inhibition by intracellular sodium. {ECO:0000269\|PubMed:10613906, ECO:0000269\|PubMed:17244820}.	P03372 Main function of 5'-partner protein: FUNCTION: Nuclear hormone receptor. The steroid hormones and their receptors are involved in the regulation of eukaryotic gene expression and affect cellular proliferation and differentiation in target tissues. Ligand-dependent nuclear transactivation involves either direct homodimer binding to a palindromic estrogen response element (ERE) sequence or association with other DNA-binding transcription factors, such as AP-1/c-Jun, c-Fos, ATF-2, Sp1 and Sp3, to mediate ERE-independent signaling. Ligand binding induces a conformational change allowing subsequent or combinatorial association with multiprotein coactivator complexes through LXXLL motifs of their respective components. Mutual transrepression occurs between the estrogen receptor (ER) and NF-kappa-B in a cell-type specific manner. Decreases NF-kappa-B DNA-binding activity and inhibits NF-kappa-B-mediated transcription from the IL6 promoter and displace RELA/p65 and associated coregulators from the promoter. Recruited to the NF-kappa-B response element of the CCL2 and IL8 promoters and can displace CREBBP. Present with NF-kappa-B components RELA/p65 and NFKB1/p50 on ERE sequences. Can also act synergistically with NF-kappa-B to activate transcription involving respective recruitment adjacent response elements; the function involves CREBBP. Can activate the transcriptional activity of TFF1. Also mediates membrane-initiated estrogen signaling involving various kinase cascades. Isoform 3 is involved in activation of NOS3 and endothelial nitric oxide production. Isoforms lacking one or several functional domains are thought to modulate transcriptional activity by competitive ligand or DNA binding and/or heterodimerization with the full-length receptor. Essential for MTA1-mediated transcriptional regulation of BRCA1 and BCAS3. Isoform 3 can bind to ERE and inhibit isoform 1. {ECO:0000269\|PubMed:10681512, ECO:0000269\|PubMed:10816575, ECO:0000269\|PubMed:11477071, ECO:0000269\|PubMed:11682626, ECO:0000269\|PubMed:14764652, ECO:0000269\|PubMed:15078875, ECO:0000269\|PubMed:15891768, ECO:0000269\|PubMed:16043358, ECO:0000269\|PubMed:16617102, ECO:0000269\|PubMed:16684779, ECO:0000269\|PubMed:17922032, ECO:0000269\|PubMed:17932106, ECO:0000269\|PubMed:18247370, ECO:0000269\|PubMed:19350539, ECO:0000269\|PubMed:20074560, ECO:0000269\|PubMed:20705611, ECO:0000269\|PubMed:21330404, ECO:0000269\|PubMed:22083956, ECO:0000269\|PubMed:7651415, ECO:0000269\|PubMed:9328340}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000366358, ENST00000368123, ENST00000431975, ENST00000541650, ENST00000263050, ENST00000342266, ENST00000474850, ENST00000537868,	ENST00000206249, ENST00000338799, ENST00000406599, ENST00000440973, ENST00000443427, ENST00000456483, ENST00000427531, ENST00000482101,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	6 X 3 X 6=108	10 X 10 X 6=600
	# samples	7	12
	** MAII score	log2(7/108*10)=-0.625604485218502 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(12/600*10)=-2.32192809488736 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: AKAP7 [Title/Abstract] AND ESR1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: AKAP7 [Title/Abstract] AND ESR1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	AKAP7(131466556)-ESR1(152415520), # samples:2
Anticipated loss of major functional domain due to fusion event.	AKAP7-ESR1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. AKAP7-ESR1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. AKAP7-ESR1 seems lost the major protein functional domain in Tgene partner, which is a CGC due to the frame-shifted ORF. AKAP7-ESR1 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. AKAP7-ESR1 seems lost the major protein functional domain in Tgene partner, which is a transcription factor due to the frame-shifted ORF. AKAP7-ESR1 seems lost the major protein functional domain in Tgene partner, which is a tumor suppressor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	ESR1	GO:0006366	transcription by RNA polymerase II	15831516
Tgene	ESR1	GO:0010629	negative regulation of gene expression	21695196
Tgene	ESR1	GO:0030520	intracellular estrogen receptor signaling pathway	9841876
Tgene	ESR1	GO:0032355	response to estradiol	15304487
Tgene	ESR1	GO:0043124	negative regulation of I-kappaB kinase/NF-kappaB signaling	7651415\|16043358
Tgene	ESR1	GO:0043433	negative regulation of DNA-binding transcription factor activity	10816575
Tgene	ESR1	GO:0043627	response to estrogen	11581164
Tgene	ESR1	GO:0045893	positive regulation of transcription, DNA-templated	9841876\|20074560
Tgene	ESR1	GO:0045899	positive regulation of RNA polymerase II transcriptional preinitiation complex assembly	9841876
Tgene	ESR1	GO:0045944	positive regulation of transcription by RNA polymerase II	11544182\|12047722\|15345745\|15831516\|18563714
Tgene	ESR1	GO:0051091	positive regulation of DNA-binding transcription factor activity	9328340\|10681512
Tgene	ESR1	GO:0071392	cellular response to estradiol stimulus	15831516

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr6:131466556/chr6:152415520)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across AKAP7 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ESR1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000431975	AKAP7	chr6	131466556	+	ENST00000440973	ESR1	chr6	152415520	+	4976	249	98	667	189
ENST00000431975	AKAP7	chr6	131466556	+	ENST00000338799	ESR1	chr6	152415520	+	755	249	98	667	189
ENST00000431975	AKAP7	chr6	131466556	+	ENST00000456483	ESR1	chr6	152415520	+	4976	249	98	667	189
ENST00000431975	AKAP7	chr6	131466556	+	ENST00000443427	ESR1	chr6	152415520	+	4976	249	98	667	189
ENST00000431975	AKAP7	chr6	131466556	+	ENST00000206249	ESR1	chr6	152415520	+	4973	249	98	667	189
ENST00000431975	AKAP7	chr6	131466556	+	ENST00000406599	ESR1	chr6	152415520	+	680	249	98	667	189
ENST00000541650	AKAP7	chr6	131466556	+	ENST00000440973	ESR1	chr6	152415520	+	4902	175	27	593	188
ENST00000541650	AKAP7	chr6	131466556	+	ENST00000338799	ESR1	chr6	152415520	+	681	175	27	593	188
ENST00000541650	AKAP7	chr6	131466556	+	ENST00000456483	ESR1	chr6	152415520	+	4902	175	27	593	188
ENST00000541650	AKAP7	chr6	131466556	+	ENST00000443427	ESR1	chr6	152415520	+	4902	175	27	593	188
ENST00000541650	AKAP7	chr6	131466556	+	ENST00000206249	ESR1	chr6	152415520	+	4899	175	27	593	188
ENST00000541650	AKAP7	chr6	131466556	+	ENST00000406599	ESR1	chr6	152415520	+	606	175	27	593	188
ENST00000368123	AKAP7	chr6	131466556	+	ENST00000440973	ESR1	chr6	152415520	+	4823	96	11	514	167
ENST00000368123	AKAP7	chr6	131466556	+	ENST00000338799	ESR1	chr6	152415520	+	602	96	11	514	167
ENST00000368123	AKAP7	chr6	131466556	+	ENST00000456483	ESR1	chr6	152415520	+	4823	96	11	514	167
ENST00000368123	AKAP7	chr6	131466556	+	ENST00000443427	ESR1	chr6	152415520	+	4823	96	11	514	167
ENST00000368123	AKAP7	chr6	131466556	+	ENST00000206249	ESR1	chr6	152415520	+	4820	96	11	514	167
ENST00000368123	AKAP7	chr6	131466556	+	ENST00000406599	ESR1	chr6	152415520	+	527	96	11	514	167

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000431975	ENST00000440973	AKAP7	chr6	131466556	+	ESR1	chr6	152415520	+	0.002212181	0.99778783
ENST00000431975	ENST00000338799	AKAP7	chr6	131466556	+	ESR1	chr6	152415520	+	0.000478852	0.99952114
ENST00000431975	ENST00000456483	AKAP7	chr6	131466556	+	ESR1	chr6	152415520	+	0.002212181	0.99778783
ENST00000431975	ENST00000443427	AKAP7	chr6	131466556	+	ESR1	chr6	152415520	+	0.002212181	0.99778783
ENST00000431975	ENST00000206249	AKAP7	chr6	131466556	+	ESR1	chr6	152415520	+	0.002506949	0.997493
ENST00000431975	ENST00000406599	AKAP7	chr6	131466556	+	ESR1	chr6	152415520	+	0.00039471	0.99960536
ENST00000541650	ENST00000440973	AKAP7	chr6	131466556	+	ESR1	chr6	152415520	+	0.001961615	0.99803835
ENST00000541650	ENST00000338799	AKAP7	chr6	131466556	+	ESR1	chr6	152415520	+	0.000406991	0.9995931
ENST00000541650	ENST00000456483	AKAP7	chr6	131466556	+	ESR1	chr6	152415520	+	0.001961615	0.99803835
ENST00000541650	ENST00000443427	AKAP7	chr6	131466556	+	ESR1	chr6	152415520	+	0.001961615	0.99803835
ENST00000541650	ENST00000206249	AKAP7	chr6	131466556	+	ESR1	chr6	152415520	+	0.002226753	0.99777323
ENST00000541650	ENST00000406599	AKAP7	chr6	131466556	+	ESR1	chr6	152415520	+	0.000314723	0.9996853
ENST00000368123	ENST00000440973	AKAP7	chr6	131466556	+	ESR1	chr6	152415520	+	0.003325003	0.996675
ENST00000368123	ENST00000338799	AKAP7	chr6	131466556	+	ESR1	chr6	152415520	+	0.000439292	0.99956065
ENST00000368123	ENST00000456483	AKAP7	chr6	131466556	+	ESR1	chr6	152415520	+	0.003325003	0.996675
ENST00000368123	ENST00000443427	AKAP7	chr6	131466556	+	ESR1	chr6	152415520	+	0.003325003	0.996675
ENST00000368123	ENST00000206249	AKAP7	chr6	131466556	+	ESR1	chr6	152415520	+	0.003933732	0.9960663
ENST00000368123	ENST00000406599	AKAP7	chr6	131466556	+	ESR1	chr6	152415520	+	0.000416133	0.9995839

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for AKAP7-ESR1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
AKAP7	chr6	131466556	ESR1	chr6	152415520	175	50	PFATVDIQDDCGRVYTFLSSTLKSLE
AKAP7	chr6	131466556	ESR1	chr6	152415520	249	51	PFATVDIQDDCGRVYTFLSSTLKSLE
AKAP7	chr6	131466556	ESR1	chr6	152415520	96	29	PFATVDIQDDCGRVYTFLSSTLKSLE

Top

Potential FusionNeoAntigen Information of AKAP7-ESR1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

AKAP7-ESR1_131466556_152415520.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B15:01	IQDDCGRVY	0.9833	0.7245	6	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-A30:08	RVYTFLSST	0.9578	0.6845	12	21
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B18:01	DDCGRVYTF	0.9034	0.7959	8	17
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B15:25	IQDDCGRVY	0.9029	0.746	6	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B15:02	IQDDCGRVY	0.8086	0.7723	6	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B27:04	GRVYTFLSSTL	1	0.5409	11	22
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-A30:08	RVYTFLSSTLK	0.9955	0.5698	12	23
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B13:01	IQDDCGRVYTF	0.9917	0.7955	6	17
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B15:05	IQDDCGRVY	0.8586	0.6659	6	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B15:21	IQDDCGRVY	0.8133	0.712	6	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B15:31	IQDDCGRVY	0.7583	0.6825	6	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-C03:14	IQDDCGRVY	0.2501	0.9493	6	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-C12:16	IQDDCGRVY	0.1766	0.9473	6	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B15:31	DIQDDCGRVY	0.9325	0.7801	5	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B15:33	IQDDCGRVY	0.9833	0.7245	6	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B15:125	IQDDCGRVY	0.9833	0.7245	6	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B15:34	IQDDCGRVY	0.9833	0.7245	6	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B15:27	IQDDCGRVY	0.983	0.7811	6	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B15:50	IQDDCGRVY	0.9825	0.8152	6	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B15:135	IQDDCGRVY	0.9803	0.7248	6	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B15:12	IQDDCGRVY	0.9689	0.7574	6	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B18:04	DDCGRVYTF	0.9511	0.8118	8	17
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B18:07	DDCGRVYTF	0.929	0.7279	8	17
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B18:06	DDCGRVYTF	0.9278	0.8057	8	17
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B18:08	DDCGRVYTF	0.911	0.5411	8	17
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B18:05	DDCGRVYTF	0.9034	0.7959	8	17
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B15:39	IQDDCGRVY	0.9016	0.5785	6	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B18:03	DDCGRVYTF	0.8929	0.7755	8	17
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B15:20	IQDDCGRVY	0.8652	0.7655	6	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B35:28	IQDDCGRVY	0.8043	0.7802	6	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B35:20	IQDDCGRVY	0.7581	0.8033	6	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B15:53	IQDDCGRVY	0.7417	0.6921	6	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B18:04	IQDDCGRVY	0.6159	0.7843	6	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-C07:17	IQDDCGRVY	0.6142	0.925	6	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B48:02	IQDDCGRVY	0.4654	0.7498	6	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B15:54	IQDDCGRVY	0.4542	0.6557	6	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-C03:02	IQDDCGRVY	0.402	0.9229	6	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-C12:02	IQDDCGRVY	0.0586	0.9566	6	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-A32:01	RVYTFLSSTL	0.9969	0.8949	12	22
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-B18:04	DIQDDCGRVY	0.8409	0.8218	5	15
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	HLA-A30:01	RVYTFLSSTLK	0.9955	0.7357	12	23

Top

Potential FusionNeoAntigen Information of AKAP7-ESR1 in HLA II

AKAP7-ESR1_131466556_152415520.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	DRB5-0101	GRVYTFLSSTLKSLE	11	26
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	DRB5-0101	CGRVYTFLSSTLKSL	10	25
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	DRB5-0101	DCGRVYTFLSSTLKS	9	24
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	DRB5-0102	GRVYTFLSSTLKSLE	11	26
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	DRB5-0102	CGRVYTFLSSTLKSL	10	25
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	DRB5-0102	DCGRVYTFLSSTLKS	9	24
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	DRB5-0104	GRVYTFLSSTLKSLE	11	26
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	DRB5-0105	GRVYTFLSSTLKSLE	11	26
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	DRB5-0105	CGRVYTFLSSTLKSL	10	25
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	DRB5-0105	DCGRVYTFLSSTLKS	9	24
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	DRB5-0108N	GRVYTFLSSTLKSLE	11	26
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	DRB5-0108N	CGRVYTFLSSTLKSL	10	25
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	DRB5-0108N	DCGRVYTFLSSTLKS	9	24
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	DRB5-0113	GRVYTFLSSTLKSLE	11	26
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	DRB5-0113	CGRVYTFLSSTLKSL	10	25
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	DRB5-0113	DCGRVYTFLSSTLKS	9	24
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	DRB5-0114	GRVYTFLSSTLKSLE	11	26
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	DRB5-0114	CGRVYTFLSSTLKSL	10	25
AKAP7-ESR1	chr6	131466556	chr6	152415520	96	DRB5-0114	DCGRVYTFLSSTLKS	9	24

Top

Fusion breakpoint peptide structures of AKAP7-ESR1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
3906	IQDDCGRVYTFLSS	AKAP7	ESR1	chr6	131466556	chr6	152415520	96

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of AKAP7-ESR1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	3906	IQDDCGRVYTFLSS	-7.88372	-7.99712
HLA-B14:02	3BVN	3906	IQDDCGRVYTFLSS	-5.34165	-6.37695
HLA-B52:01	3W39	3906	IQDDCGRVYTFLSS	-6.76573	-6.87913
HLA-B52:01	3W39	3906	IQDDCGRVYTFLSS	-5.28832	-6.32362
HLA-A24:02	5HGA	3906	IQDDCGRVYTFLSS	-7.78551	-7.89891
HLA-A24:02	5HGA	3906	IQDDCGRVYTFLSS	-5.13058	-6.16588
HLA-B44:05	3DX8	3906	IQDDCGRVYTFLSS	-6.02716	-6.14056
HLA-B44:05	3DX8	3906	IQDDCGRVYTFLSS	-3.54334	-4.57864
HLA-A02:01	6TDR	3906	IQDDCGRVYTFLSS	-4.9342	-5.0476
HLA-A02:01	6TDR	3906	IQDDCGRVYTFLSS	-1.37769	-2.41299

Top

Vaccine Design for the FusionNeoAntigens of AKAP7-ESR1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
AKAP7-ESR1	chr6	131466556	chr6	152415520	11	22	GRVYTFLSSTL	GTGGAAGAGTGTACACATTTCTGTCCAGCACCC
AKAP7-ESR1	chr6	131466556	chr6	152415520	12	21	RVYTFLSST	GAAGAGTGTACACATTTCTGTCCAGCA
AKAP7-ESR1	chr6	131466556	chr6	152415520	12	22	RVYTFLSSTL	GAAGAGTGTACACATTTCTGTCCAGCACCC
AKAP7-ESR1	chr6	131466556	chr6	152415520	12	23	RVYTFLSSTLK	GAAGAGTGTACACATTTCTGTCCAGCACCCTGA
AKAP7-ESR1	chr6	131466556	chr6	152415520	5	15	DIQDDCGRVY	TAGATATTCAGGATGACTGTGGAAGAGTGT
AKAP7-ESR1	chr6	131466556	chr6	152415520	6	15	IQDDCGRVY	ATATTCAGGATGACTGTGGAAGAGTGT
AKAP7-ESR1	chr6	131466556	chr6	152415520	6	17	IQDDCGRVYTF	ATATTCAGGATGACTGTGGAAGAGTGTACACAT
AKAP7-ESR1	chr6	131466556	chr6	152415520	8	17	DDCGRVYTF	AGGATGACTGTGGAAGAGTGTACACAT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
AKAP7-ESR1	chr6	131466556	chr6	152415520	10	25	CGRVYTFLSSTLKSL	ACTGTGGAAGAGTGTACACATTTCTGTCCAGCACCCTGAAGTCTC
AKAP7-ESR1	chr6	131466556	chr6	152415520	11	26	GRVYTFLSSTLKSLE	GTGGAAGAGTGTACACATTTCTGTCCAGCACCCTGAAGTCTCTGG
AKAP7-ESR1	chr6	131466556	chr6	152415520	9	24	DCGRVYTFLSSTLKS	ATGACTGTGGAAGAGTGTACACATTTCTGTCCAGCACCCTGAAGT

Top

Information of the samples that have these potential fusion neoantigens of AKAP7-ESR1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	AKAP7-ESR1	chr6	131466556	ENST00000368123	chr6	152415520	ENST00000206249	TCGA-A8-A08I-01A

Top

Potential target of CAR-T therapy development for AKAP7-ESR1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to AKAP7-ESR1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to AKAP7-ESR1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)