Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:GSS-TTI1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: GSS-TTI1
	FusionPDB ID: 35100
	FusionGDB2.0 ID: 35100
		Hgene	Tgene
	Gene symbol	GSS	TTI1
	Gene ID	5621	9675
	Gene name	prion protein	TELO2 interacting protein 1
	Synonyms	ASCR\|AltPrP\|CD230\|CJD\|GSS\|KURU\|PRIP\|PrP\|PrP27-30\|PrP33-35C\|PrPc\|p27-30	KIAA0406\|smg-10
	Cytomap	20p13	20q11.23
	Type of gene	protein-coding	protein-coding
	Description	major prion proteinalternative prion proteinCD230 antigenprion-related protein	TELO2-interacting protein 1 homologTEL2-interacting protein 1 homologTel two interacting protein 1smg-10 homolog, nonsense mediated mRNA decay factor
	Modification date	20200315	20200313
	UniProtAcc	P48637 Main function of 5'-partner protein:	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000216951, ENST00000541098, ENST00000451957,	ENST00000487362, ENST00000373447, ENST00000373448, ENST00000449821,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	8 X 8 X 4=256	9 X 7 X 6=378
	# samples	10	9
	** MAII score	log2(10/256*10)=-1.35614381022528 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(9/378*10)=-2.0703893278914 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: GSS [Title/Abstract] AND TTI1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: GSS [Title/Abstract] AND TTI1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	GSS(33529516)-TTI1(36627730), # samples:1
Anticipated loss of major functional domain due to fusion event.	GSS-TTI1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. GSS-TTI1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. GSS-TTI1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. GSS-TTI1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. GSS-TTI1 seems lost the major protein functional domain in Hgene partner, which is a cell metabolism gene due to the frame-shifted ORF. GSS-TTI1 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. GSS-TTI1 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	GSS	GO:0050731	positive regulation of peptidyl-tyrosine phosphorylation	22820466
Hgene	GSS	GO:0071280	cellular response to copper ion	16254249

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr20:33529516/chr20:36627730)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across GSS (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across TTI1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000216951	GSS	chr20	33529516	-	ENST00000373448	TTI1	chr20	36627730	-	1774	707	99	935	278
ENST00000216951	GSS	chr20	33529516	-	ENST00000373447	TTI1	chr20	36627730	-	1774	707	99	935	278
ENST00000216951	GSS	chr20	33529516	-	ENST00000449821	TTI1	chr20	36627730	-	1759	707	99	935	278

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000216951	ENST00000373448	GSS	chr20	33529516	-	TTI1	chr20	36627730	-	0.21565895	0.7843411
ENST00000216951	ENST00000373447	GSS	chr20	33529516	-	TTI1	chr20	36627730	-	0.21565895	0.7843411
ENST00000216951	ENST00000449821	GSS	chr20	33529516	-	TTI1	chr20	36627730	-	0.22243443	0.77756554

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for GSS-TTI1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
GSS	chr20	33529516	TTI1	chr20	36627730	707	203	GIAKAWELYGSPKSWMCWICVWLFFS

Top

Potential FusionNeoAntigen Information of GSS-TTI1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

GSS-TTI1_33529516_36627730.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B57:01	GSPKSWMCW	0.9944	0.969	9	18
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B58:02	GSPKSWMCW	0.9863	0.9383	9	18
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B58:02	ELYGSPKSW	0.719	0.972	6	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-A26:15	ELYGSPKSW	0.7109	0.7186	6	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-A26:14	ELYGSPKSW	0.7109	0.7186	6	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-A32:13	ELYGSPKSW	0.7054	0.9928	6	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B57:01	YGSPKSWMCW	0.9997	0.9668	8	18
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B58:02	YGSPKSWMCW	0.9991	0.9403	8	18
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B58:01	YGSPKSWMCW	0.9989	0.9395	8	18
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B44:03	WELYGSPKSW	0.9889	0.9841	5	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B44:02	WELYGSPKSW	0.9744	0.7065	5	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B44:05	WELYGSPKSW	0.9474	0.8464	5	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-A24:17	AWELYGSPKSW	0.9971	0.7195	4	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-A31:08	AWELYGSPKSW	0.9969	0.5882	4	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-A32:13	AWELYGSPKSW	0.9959	0.9783	4	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-A26:01	ELYGSPKSW	0.7109	0.7186	6	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B44:08	ELYGSPKSW	0.1015	0.6947	6	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B44:08	WELYGSPKSW	0.9804	0.7448	5	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B44:09	WELYGSPKSW	0.9197	0.8124	5	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B44:10	WELYGSPKSW	0.5929	0.8419	5	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B57:10	GSPKSWMCW	0.9944	0.969	9	18
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B58:06	GSPKSWMCW	0.9836	0.9023	9	18
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B57:04	GSPKSWMCW	0.9823	0.7857	9	18
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-A25:01	ELYGSPKSW	0.9558	0.9713	6	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B57:02	GSPKSWMCW	0.8779	0.9329	9	18
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B15:13	ELYGSPKSW	0.8662	0.896	6	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B15:24	ELYGSPKSW	0.8556	0.9799	6	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B58:06	ELYGSPKSW	0.829	0.9329	6	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-A32:01	ELYGSPKSW	0.648	0.9819	6	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B53:02	ELYGSPKSW	0.4017	0.527	6	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-C14:02	LYGSPKSWM	0.0797	0.9865	7	16
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-C14:03	LYGSPKSWM	0.0797	0.9865	7	16
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B57:10	YGSPKSWMCW	0.9997	0.9668	8	18
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B57:04	YGSPKSWMCW	0.9988	0.7863	8	18
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B57:02	YGSPKSWMCW	0.9903	0.9404	8	18
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B44:26	WELYGSPKSW	0.9889	0.9841	5	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B44:07	WELYGSPKSW	0.9889	0.9841	5	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B44:13	WELYGSPKSW	0.9889	0.9841	5	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B44:22	WELYGSPKSW	0.9744	0.7065	5	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B44:21	WELYGSPKSW	0.9549	0.623	5	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B15:24	WELYGSPKSW	0.9301	0.9771	5	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B15:13	WELYGSPKSW	0.8558	0.8944	5	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-A32:01	AWELYGSPKSW	0.996	0.9771	4	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	HLA-B15:24	AWELYGSPKSW	0.9912	0.9829	4	15

Top

Potential FusionNeoAntigen Information of GSS-TTI1 in HLA II

GSS-TTI1_33529516_36627730.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1502	IAKAWELYGSPKSWM	1	16
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1502	GIAKAWELYGSPKSW	0	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1502	AKAWELYGSPKSWMC	2	17
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1508	IAKAWELYGSPKSWM	1	16
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1508	GIAKAWELYGSPKSW	0	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1508	AKAWELYGSPKSWMC	2	17
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1511	IAKAWELYGSPKSWM	1	16
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1511	GIAKAWELYGSPKSW	0	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1511	AKAWELYGSPKSWMC	2	17
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1514	IAKAWELYGSPKSWM	1	16
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1514	GIAKAWELYGSPKSW	0	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1514	AKAWELYGSPKSWMC	2	17
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1515	IAKAWELYGSPKSWM	1	16
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1515	GIAKAWELYGSPKSW	0	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1519	IAKAWELYGSPKSWM	1	16
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1519	GIAKAWELYGSPKSW	0	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1519	AKAWELYGSPKSWMC	2	17
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1526	IAKAWELYGSPKSWM	1	16
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1526	GIAKAWELYGSPKSW	0	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1526	AKAWELYGSPKSWMC	2	17
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1530	IAKAWELYGSPKSWM	1	16
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1530	GIAKAWELYGSPKSW	0	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1531	IAKAWELYGSPKSWM	1	16
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1531	GIAKAWELYGSPKSW	0	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1531	AKAWELYGSPKSWMC	2	17
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1538	IAKAWELYGSPKSWM	1	16
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1538	GIAKAWELYGSPKSW	0	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1538	AKAWELYGSPKSWMC	2	17
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1539	IAKAWELYGSPKSWM	1	16
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1539	GIAKAWELYGSPKSW	0	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1539	AKAWELYGSPKSWMC	2	17
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1544	IAKAWELYGSPKSWM	1	16
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1544	GIAKAWELYGSPKSW	0	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1544	AKAWELYGSPKSWMC	2	17
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1547	IAKAWELYGSPKSWM	1	16
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1547	GIAKAWELYGSPKSW	0	15
GSS-TTI1	chr20	33529516	chr20	36627730	707	DRB1-1547	AKAWELYGSPKSWMC	2	17

Top

Fusion breakpoint peptide structures of GSS-TTI1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
1939	ELYGSPKSWMCWIC	GSS	TTI1	chr20	33529516	chr20	36627730	707

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of GSS-TTI1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	1939	ELYGSPKSWMCWIC	-7.9962	-8.1096
HLA-B14:02	3BVN	1939	ELYGSPKSWMCWIC	-5.70842	-6.74372
HLA-B52:01	3W39	1939	ELYGSPKSWMCWIC	-6.83737	-6.95077
HLA-B52:01	3W39	1939	ELYGSPKSWMCWIC	-4.4836	-5.5189
HLA-A11:01	4UQ2	1939	ELYGSPKSWMCWIC	-10.0067	-10.1201
HLA-A11:01	4UQ2	1939	ELYGSPKSWMCWIC	-9.03915	-10.0745
HLA-A24:02	5HGA	1939	ELYGSPKSWMCWIC	-6.56204	-6.67544
HLA-A24:02	5HGA	1939	ELYGSPKSWMCWIC	-5.42271	-6.45801
HLA-B44:05	3DX8	1939	ELYGSPKSWMCWIC	-7.85648	-8.89178
HLA-B44:05	3DX8	1939	ELYGSPKSWMCWIC	-5.3978	-5.5112
HLA-A02:01	6TDR	1939	ELYGSPKSWMCWIC	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of GSS-TTI1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
GSS-TTI1	chr20	33529516	chr20	36627730	4	15	AWELYGSPKSW	AGCCTGGGAGCTCTACGGCTCACCCAAGTCTTG
GSS-TTI1	chr20	33529516	chr20	36627730	5	15	WELYGSPKSW	CTGGGAGCTCTACGGCTCACCCAAGTCTTG
GSS-TTI1	chr20	33529516	chr20	36627730	6	15	ELYGSPKSW	GGAGCTCTACGGCTCACCCAAGTCTTG
GSS-TTI1	chr20	33529516	chr20	36627730	7	16	LYGSPKSWM	GCTCTACGGCTCACCCAAGTCTTGGAT
GSS-TTI1	chr20	33529516	chr20	36627730	8	18	YGSPKSWMCW	CTACGGCTCACCCAAGTCTTGGATGTGCTG
GSS-TTI1	chr20	33529516	chr20	36627730	9	18	GSPKSWMCW	CGGCTCACCCAAGTCTTGGATGTGCTG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
GSS-TTI1	chr20	33529516	chr20	36627730	0	15	GIAKAWELYGSPKSW	GGGAATTGCCAAAGCCTGGGAGCTCTACGGCTCACCCAAGTCTTG
GSS-TTI1	chr20	33529516	chr20	36627730	1	16	IAKAWELYGSPKSWM	AATTGCCAAAGCCTGGGAGCTCTACGGCTCACCCAAGTCTTGGAT
GSS-TTI1	chr20	33529516	chr20	36627730	2	17	AKAWELYGSPKSWMC	TGCCAAAGCCTGGGAGCTCTACGGCTCACCCAAGTCTTGGATGTG

Top

Information of the samples that have these potential fusion neoantigens of GSS-TTI1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LUAD	GSS-TTI1	chr20	33529516	ENST00000216951	chr20	36627730	ENST00000373447	TCGA-55-8097-01A

Top

Potential target of CAR-T therapy development for GSS-TTI1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to GSS-TTI1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to GSS-TTI1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)