Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:GTPBP4-NIN

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: GTPBP4-NIN
	FusionPDB ID: 35317
	FusionGDB2.0 ID: 35317
		Hgene	Tgene
	Gene symbol	GTPBP4	NIN
	Gene ID	23560	51199
	Gene name	GTP binding protein 4	ninein
	Synonyms	CRFG\|NGB\|NOG1	SCKL7
	Cytomap	10p15.3	14q22.1
	Type of gene	protein-coding	protein-coding
	Description	nucleolar GTP-binding protein 1G protein-binding protein CRFGGTP-binding protein NGBchronic renal failure gene protein	nineinglycogen synthase kinase 3 beta-interacting proteinhNineinninein (GSK3B interacting protein)ninein centrosomal protein
	Modification date	20200313	20200328
	UniProtAcc	Q9BZE4 Main function of 5'-partner protein: FUNCTION: Involved in the biogenesis of the 60S ribosomal subunit. {ECO:0000250}.	Q9Y2I6 Main function of 5'-partner protein: FUNCTION: Involved in the microtubule organization in interphase cells. Overexpression induces the fragmentation of the Golgi, and causes lysosomes to disperse toward the cell periphery; it also interferes with mitotic spindle assembly. May play a role in ovarian carcinogenesis. {ECO:0000269\|PubMed:12852856, ECO:0000269\|PubMed:16254247, ECO:0000269\|PubMed:18538832}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000360803, ENST00000538293, ENST00000545048, ENST00000491635,	ENST00000486200, ENST00000245441, ENST00000324330, ENST00000382041, ENST00000382043, ENST00000389868, ENST00000453196, ENST00000530997,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	6 X 6 X 4=144	7 X 9 X 4=252
	# samples	6	10
	** MAII score	log2(6/144*10)=-1.26303440583379 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(10/252*10)=-1.33342373372519 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: GTPBP4 [Title/Abstract] AND NIN [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: GTPBP4 [Title/Abstract] AND NIN [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	GTPBP4(1058553)-NIN(51226937), # samples:1
Anticipated loss of major functional domain due to fusion event.	GTPBP4-NIN seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. GTPBP4-NIN seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. GTPBP4-NIN seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. GTPBP4-NIN seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	GTPBP4	GO:0000079	regulation of cyclin-dependent protein serine/threonine kinase activity	17210637
Hgene	GTPBP4	GO:0022408	negative regulation of cell-cell adhesion	17210637
Hgene	GTPBP4	GO:0030336	negative regulation of cell migration	17210637
Hgene	GTPBP4	GO:0031397	negative regulation of protein ubiquitination	17210637
Hgene	GTPBP4	GO:0050821	protein stabilization	17210637

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr10:1058553/chr14:51226937)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across GTPBP4 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across NIN (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000360803	GTPBP4	chr10	1058553	+	ENST00000245441	NIN	chr14	51226937	-	9541	1475	6950	9538	863
ENST00000360803	GTPBP4	chr10	1058553	+	ENST00000389868	NIN	chr14	51226937	-	7463	1475	22	1470	482
ENST00000360803	GTPBP4	chr10	1058553	+	ENST00000530997	NIN	chr14	51226937	-	7807	1475	5216	7804	863
ENST00000360803	GTPBP4	chr10	1058553	+	ENST00000382043	NIN	chr14	51226937	-	3618	1475	22	1470	482
ENST00000360803	GTPBP4	chr10	1058553	+	ENST00000382041	NIN	chr14	51226937	-	5744	1475	3153	5741	863
ENST00000360803	GTPBP4	chr10	1058553	+	ENST00000324330	NIN	chr14	51226937	-	5773	1475	3182	5770	863
ENST00000360803	GTPBP4	chr10	1058553	+	ENST00000453196	NIN	chr14	51226937	-	6033	1475	3442	6030	863
ENST00000538293	GTPBP4	chr10	1058553	+	ENST00000245441	NIN	chr14	51226937	-	9373	1307	6782	9370	863
ENST00000538293	GTPBP4	chr10	1058553	+	ENST00000389868	NIN	chr14	51226937	-	7295	1307	5602	6789	395
ENST00000538293	GTPBP4	chr10	1058553	+	ENST00000530997	NIN	chr14	51226937	-	7639	1307	5048	7636	863
ENST00000538293	GTPBP4	chr10	1058553	+	ENST00000382043	NIN	chr14	51226937	-	3450	1307	1547	2944	465
ENST00000538293	GTPBP4	chr10	1058553	+	ENST00000382041	NIN	chr14	51226937	-	5576	1307	2985	5573	863
ENST00000538293	GTPBP4	chr10	1058553	+	ENST00000324330	NIN	chr14	51226937	-	5605	1307	3014	5602	863
ENST00000538293	GTPBP4	chr10	1058553	+	ENST00000453196	NIN	chr14	51226937	-	5865	1307	3274	5862	863
ENST00000545048	GTPBP4	chr10	1058553	+	ENST00000245441	NIN	chr14	51226937	-	9645	1579	7054	9642	863
ENST00000545048	GTPBP4	chr10	1058553	+	ENST00000389868	NIN	chr14	51226937	-	7567	1579	252	1574	440
ENST00000545048	GTPBP4	chr10	1058553	+	ENST00000530997	NIN	chr14	51226937	-	7911	1579	5320	7908	863
ENST00000545048	GTPBP4	chr10	1058553	+	ENST00000382043	NIN	chr14	51226937	-	3722	1579	1819	3216	465
ENST00000545048	GTPBP4	chr10	1058553	+	ENST00000382041	NIN	chr14	51226937	-	5848	1579	3257	5845	863
ENST00000545048	GTPBP4	chr10	1058553	+	ENST00000324330	NIN	chr14	51226937	-	5877	1579	3286	5874	863
ENST00000545048	GTPBP4	chr10	1058553	+	ENST00000453196	NIN	chr14	51226937	-	6137	1579	3546	6134	863

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000360803	ENST00000245441	GTPBP4	chr10	1058553	+	NIN	chr14	51226937	-	0.004162533	0.99583745
ENST00000360803	ENST00000389868	GTPBP4	chr10	1058553	+	NIN	chr14	51226937	-	0.000333532	0.99966645
ENST00000360803	ENST00000530997	GTPBP4	chr10	1058553	+	NIN	chr14	51226937	-	0.005663264	0.9943368
ENST00000360803	ENST00000382043	GTPBP4	chr10	1058553	+	NIN	chr14	51226937	-	0.008555552	0.9914445
ENST00000360803	ENST00000382041	GTPBP4	chr10	1058553	+	NIN	chr14	51226937	-	0.023462692	0.97653735
ENST00000360803	ENST00000324330	GTPBP4	chr10	1058553	+	NIN	chr14	51226937	-	0.006554278	0.9934457
ENST00000360803	ENST00000453196	GTPBP4	chr10	1058553	+	NIN	chr14	51226937	-	0.007844891	0.99215513
ENST00000538293	ENST00000245441	GTPBP4	chr10	1058553	+	NIN	chr14	51226937	-	0.003933481	0.9960665
ENST00000538293	ENST00000389868	GTPBP4	chr10	1058553	+	NIN	chr14	51226937	-	0.000655551	0.9993444
ENST00000538293	ENST00000530997	GTPBP4	chr10	1058553	+	NIN	chr14	51226937	-	0.006248809	0.9937512
ENST00000538293	ENST00000382043	GTPBP4	chr10	1058553	+	NIN	chr14	51226937	-	0.010803792	0.9891962
ENST00000538293	ENST00000382041	GTPBP4	chr10	1058553	+	NIN	chr14	51226937	-	0.026817799	0.97318226
ENST00000538293	ENST00000324330	GTPBP4	chr10	1058553	+	NIN	chr14	51226937	-	0.008193635	0.9918064
ENST00000538293	ENST00000453196	GTPBP4	chr10	1058553	+	NIN	chr14	51226937	-	0.009200517	0.9907995
ENST00000545048	ENST00000245441	GTPBP4	chr10	1058553	+	NIN	chr14	51226937	-	0.004288031	0.9957119
ENST00000545048	ENST00000389868	GTPBP4	chr10	1058553	+	NIN	chr14	51226937	-	0.000438378	0.9995616
ENST00000545048	ENST00000530997	GTPBP4	chr10	1058553	+	NIN	chr14	51226937	-	0.00538466	0.9946154
ENST00000545048	ENST00000382043	GTPBP4	chr10	1058553	+	NIN	chr14	51226937	-	0.008025463	0.99197453
ENST00000545048	ENST00000382041	GTPBP4	chr10	1058553	+	NIN	chr14	51226937	-	0.022161825	0.9778382
ENST00000545048	ENST00000324330	GTPBP4	chr10	1058553	+	NIN	chr14	51226937	-	0.007126329	0.99287367
ENST00000545048	ENST00000453196	GTPBP4	chr10	1058553	+	NIN	chr14	51226937	-	0.007087235	0.9929128

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for GTPBP4-NIN

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
GTPBP4	chr10	1058553	NIN	chr14	51226937	1307	743	TCSEMQQKVELLSQGQAAVLKEAHHE
GTPBP4	chr10	1058553	NIN	chr14	51226937	1475	743	TCSEMQQKVELLSQGQAAVLKEAHHE
GTPBP4	chr10	1058553	NIN	chr14	51226937	1579	743	TCSEMQQKVELLSQGQAAVLKEAHHE

Top

Potential FusionNeoAntigen Information of GTPBP4-NIN in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

GTPBP4-NIN_1058553_51226937.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-A02:22	LLSQGQAAV	0.9956	0.7448	10	19
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-A02:13	LLSQGQAAV	0.9928	0.8071	10	19
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-A02:27	LLSQGQAAV	0.9905	0.7588	10	19
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-A02:11	LLSQGQAAV	0.9874	0.716	10	19
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-A02:24	LLSQGQAAV	0.9859	0.7008	10	19
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-A02:30	LLSQGQAAV	0.9859	0.7008	10	19
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-A02:67	LLSQGQAAV	0.9859	0.7008	10	19
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-A02:60	LLSQGQAAV	0.9851	0.7262	10	19
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-A02:16	LLSQGQAAV	0.9817	0.6019	10	19
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-A02:19	LLSQGQAAV	0.9782	0.6735	10	19
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-B45:01	VELLSQGQA	0.9776	0.9705	8	17
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-A02:38	LLSQGQAAV	0.9664	0.7365	10	19
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-B50:02	VELLSQGQA	0.9588	0.8476	8	17
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-A02:35	LLSQGQAAV	0.9327	0.7112	10	19
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-A02:29	LLSQGQAAV	0.9267	0.7026	10	19
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-A02:20	LLSQGQAAV	0.8974	0.7108	10	19
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-B41:01	VELLSQGQA	0.2819	0.9202	8	17
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-B50:01	VELLSQGQA	0.2748	0.9668	8	17
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-B45:01	VELLSQGQAA	0.9783	0.989	8	18
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-B50:02	VELLSQGQAA	0.9513	0.9017	8	18
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-B50:01	VELLSQGQAA	0.8502	0.9835	8	18
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-B41:01	VELLSQGQAA	0.8018	0.983	8	18
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-C03:07	LSQGQAAVL	0.9995	0.9612	11	20
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-C03:19	LSQGQAAVL	0.9994	0.9929	11	20
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-C03:08	LSQGQAAVL	0.9993	0.9408	11	20
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-C15:06	LSQGQAAVL	0.9984	0.932	11	20
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-A02:02	LLSQGQAAV	0.9956	0.6939	10	19
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-A02:01	LLSQGQAAV	0.9859	0.7008	10	19
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-B40:06	VELLSQGQA	0.9593	0.873	8	17
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-C08:04	LSQGQAAVL	0.9453	0.9887	11	20
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-C08:13	LSQGQAAVL	0.9453	0.9887	11	20
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-B40:06	VELLSQGQAA	0.9671	0.954	8	18
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-C03:04	LSQGQAAVL	0.9995	0.9913	11	20
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-C03:03	LSQGQAAVL	0.9995	0.9913	11	20
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-C03:05	LSQGQAAVL	0.9988	0.952	11	20
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-C03:17	LSQGQAAVL	0.9988	0.9737	11	20
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-C15:05	LSQGQAAVL	0.998	0.9485	11	20
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-A02:03	LLSQGQAAV	0.9963	0.8263	10	19
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-C03:06	LSQGQAAVL	0.9776	0.9924	11	20
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-C16:01	LSQGQAAVL	0.9237	0.9838	11	20
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-B50:04	VELLSQGQA	0.2748	0.9668	8	17
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-B50:05	VELLSQGQA	0.2748	0.9668	8	17
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-B50:05	VELLSQGQAA	0.8502	0.9835	8	18
GTPBP4-NIN	chr10	1058553	chr14	51226937	1475	HLA-B50:04	VELLSQGQAA	0.8502	0.9835	8	18

Top

Potential FusionNeoAntigen Information of GTPBP4-NIN in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of GTPBP4-NIN

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7367	QKVELLSQGQAAVL	GTPBP4	NIN	chr10	1058553	chr14	51226937	1475

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of GTPBP4-NIN

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	7367	QKVELLSQGQAAVL	-7.15543	-7.26883
HLA-B14:02	3BVN	7367	QKVELLSQGQAAVL	-4.77435	-5.80965
HLA-B52:01	3W39	7367	QKVELLSQGQAAVL	-6.80875	-6.92215
HLA-B52:01	3W39	7367	QKVELLSQGQAAVL	-4.20386	-5.23916
HLA-A11:01	4UQ2	7367	QKVELLSQGQAAVL	-7.5194	-8.5547
HLA-A11:01	4UQ2	7367	QKVELLSQGQAAVL	-6.9601	-7.0735
HLA-A24:02	5HGA	7367	QKVELLSQGQAAVL	-7.52403	-7.63743
HLA-A24:02	5HGA	7367	QKVELLSQGQAAVL	-5.82433	-6.85963
HLA-B27:05	6PYJ	7367	QKVELLSQGQAAVL	-3.28285	-4.31815
HLA-B44:05	3DX8	7367	QKVELLSQGQAAVL	-5.91172	-6.94702
HLA-B44:05	3DX8	7367	QKVELLSQGQAAVL	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of GTPBP4-NIN

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
GTPBP4-NIN	chr10	1058553	chr14	51226937	10	19	LLSQGQAAV	GCTAAGAAGCTCTGCAAGAACACTAAG
GTPBP4-NIN	chr10	1058553	chr14	51226937	11	20	LSQGQAAVL	AAGAAGCTCTGCAAGAACACTAAGGCA
GTPBP4-NIN	chr10	1058553	chr14	51226937	8	17	VELLSQGQA	CGAACTGCTAAGAAGCTCTGCAAGAAC
GTPBP4-NIN	chr10	1058553	chr14	51226937	8	18	VELLSQGQAA	CGAACTGCTAAGAAGCTCTGCAAGAACACT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of GTPBP4-NIN

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
N/A	GTPBP4-NIN	chr10	1058553	ENST00000360803	chr14	51226937	ENST00000245441	AW361086

Top

Potential target of CAR-T therapy development for GTPBP4-NIN

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to GTPBP4-NIN

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to GTPBP4-NIN

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Tgene	NIN	C3553870	SECKEL SYNDROME 7	2	GENOMICS_ENGLAND;ORPHANET;UNIPROT

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)