|
|||||||
|
Fusion Protein:HERC1-DAPK2 |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: HERC1-DAPK2 | FusionPDB ID: 36131 | FusionGDB2.0 ID: 36131 | Hgene | Tgene | Gene symbol | HERC1 | DAPK2 | Gene ID | 8925 | 23604 |
| Gene name | HECT and RLD domain containing E3 ubiquitin protein ligase family member 1 | death associated protein kinase 2 | |
| Synonyms | MDFPMR|p532|p619 | DRP-1|DRP1 | |
| Cytomap | 15q22.31 | 15q22.31 | |
| Type of gene | protein-coding | protein-coding | |
| Description | probable E3 ubiquitin-protein ligase HERC1HECT domain and RCC1-like domain-containing protein 1HECT-type E3 ubiquitin transferase HERC1guanine nucleotide exchange factor p532hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC | death-associated protein kinase 2DAP kinase 2DAP-kinase-related protein 1 beta isoform | |
| Modification date | 20200313 | 20200313 | |
| UniProtAcc | Q15751 Main function of 5'-partner protein: FUNCTION: Involved in membrane trafficking via some guanine nucleotide exchange factor (GEF) activity and its ability to bind clathrin. Acts as a GEF for Arf and Rab, by exchanging bound GDP for free GTP. Binds phosphatidylinositol 4,5-bisphosphate, which is required for GEF activity. May also act as a E3 ubiquitin-protein ligase which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates. {ECO:0000269|PubMed:15642342, ECO:0000269|PubMed:8861955, ECO:0000269|PubMed:9233772}. | Q9UIK4 Main function of 5'-partner protein: FUNCTION: Calcium/calmodulin-dependent serine/threonine kinase involved in multiple cellular signaling pathways that trigger cell survival, apoptosis, and autophagy. Regulates both type I apoptotic and type II autophagic cell death signals, depending on the cellular setting. The former is caspase-dependent, while the latter is caspase-independent and is characterized by the accumulation of autophagic vesicles. Acts as a mediator of anoikis and a suppressor of beta-catenin-dependent anchorage-independent growth of malignant epithelial cells. May play a role in granulocytic maturation (PubMed:17347302). Regulates granulocytic motility by controlling cell spreading and polarization (PubMed:24163421). {ECO:0000269|PubMed:17347302, ECO:0000269|PubMed:24163421, ECO:0000269|PubMed:26047703}.; FUNCTION: Isoform 2 is not regulated by calmodulin. It can phosphorylate MYL9. It can induce membrane blebbing and autophagic cell death. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000443617, | ENST00000558482, ENST00000261891, ENST00000457488, ENST00000558069, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 16 X 17 X 10=2720 | 8 X 9 X 8=576 |
| # samples | 22 | 13 | |
| ** MAII score | log2(22/2720*10)=-3.62803122261304 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(13/576*10)=-2.14755718841386 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: HERC1 [Title/Abstract] AND DAPK2 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: HERC1 [Title/Abstract] AND DAPK2 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | HERC1(64126026)-DAPK2(64231560), # samples:3 HERC1(64126026)-DAPK2(64204396), # samples:3 DAPK2(64275732)-HERC1(63901465), # samples:1 | ||
| Anticipated loss of major functional domain due to fusion event. | HERC1-DAPK2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. HERC1-DAPK2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. HERC1-DAPK2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. HERC1-DAPK2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. HERC1-DAPK2 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. HERC1-DAPK2 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. HERC1-DAPK2 seems lost the major protein functional domain in Tgene partner, which is a kinase due to the frame-shifted ORF. HERC1-DAPK2 seems lost the major protein functional domain in Tgene partner, which is a tumor suppressor due to the frame-shifted ORF. DAPK2-HERC1 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. DAPK2-HERC1 seems lost the major protein functional domain in Hgene partner, which is a kinase due to the frame-shifted ORF. DAPK2-HERC1 seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF. DAPK2-HERC1 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Tgene | DAPK2 | GO:0006468 | protein phosphorylation | 10376525 |
| Tgene | DAPK2 | GO:0035556 | intracellular signal transduction | 10376525 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr15:64126026/chr15:64231560) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across HERC1 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across DAPK2 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000443617 | HERC1 | chr15 | 63988323 | - | ENST00000261891 | DAPK2 | chr15 | 64263760 | - | 7492 | 5209 | 88 | 5262 | 1724 |
| ENST00000443617 | HERC1 | chr15 | 63988323 | - | ENST00000457488 | DAPK2 | chr15 | 64263760 | - | 6605 | 5209 | 88 | 5262 | 1724 |
| ENST00000443617 | HERC1 | chr15 | 63988323 | - | ENST00000558069 | DAPK2 | chr15 | 64263760 | - | 6362 | 5209 | 88 | 5262 | 1724 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000443617 | ENST00000261891 | HERC1 | chr15 | 63988323 | - | DAPK2 | chr15 | 64263760 | - | 0.001634195 | 0.9983658 |
| ENST00000443617 | ENST00000457488 | HERC1 | chr15 | 63988323 | - | DAPK2 | chr15 | 64263760 | - | 0.002150588 | 0.99784946 |
| ENST00000443617 | ENST00000558069 | HERC1 | chr15 | 63988323 | - | DAPK2 | chr15 | 64263760 | - | 0.00263998 | 0.99736005 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for HERC1-DAPK2 |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| HERC1 | chr15 | 63988323 | DAPK2 | chr15 | 64263760 | 5209 | 1706 | TGGKGESGRLHHYQSVWRRALRFPGP |
Top |
Potential FusionNeoAntigen Information of HERC1-DAPK2 in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| HERC1-DAPK2_63988323_64263760.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-A33:05 | HYQSVWRR | 0.9924 | 0.6227 | 11 | 19 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-A33:01 | HYQSVWRR | 0.9924 | 0.6227 | 11 | 19 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B27:07 | GRLHHYQSV | 0.9998 | 0.8191 | 7 | 16 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B27:04 | GRLHHYQSV | 0.9998 | 0.8753 | 7 | 16 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B27:05 | GRLHHYQSV | 0.9998 | 0.9099 | 7 | 16 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B27:02 | GRLHHYQSV | 0.9998 | 0.7712 | 7 | 16 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B57:01 | RLHHYQSVW | 0.9966 | 0.9951 | 8 | 17 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-A31:08 | RLHHYQSVW | 0.9955 | 0.8377 | 8 | 17 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B39:24 | YQSVWRRAL | 0.993 | 0.681 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B58:02 | RLHHYQSVW | 0.9913 | 0.9899 | 8 | 17 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B14:02 | YQSVWRRAL | 0.9902 | 0.9495 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B14:02 | GRLHHYQSV | 0.9902 | 0.8936 | 7 | 16 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B14:01 | GRLHHYQSV | 0.9902 | 0.8936 | 7 | 16 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B14:01 | YQSVWRRAL | 0.9902 | 0.9495 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-A32:13 | RLHHYQSVW | 0.9899 | 0.9892 | 8 | 17 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B58:01 | RLHHYQSVW | 0.9894 | 0.9917 | 8 | 17 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B39:01 | YQSVWRRAL | 0.9827 | 0.9669 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B48:01 | YQSVWRRAL | 0.9789 | 0.6256 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-A33:05 | HHYQSVWRR | 0.9645 | 0.6909 | 10 | 19 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-A33:01 | HHYQSVWRR | 0.9645 | 0.6909 | 10 | 19 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B15:17 | RLHHYQSVW | 0.9504 | 0.9905 | 8 | 17 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B15:10 | YQSVWRRAL | 0.8027 | 0.636 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-A31:02 | HHYQSVWRR | 0.7457 | 0.9105 | 10 | 19 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B07:10 | YQSVWRRAL | 0.7 | 0.5886 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B15:37 | YQSVWRRAL | 0.5976 | 0.7172 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B27:02 | GRLHHYQSVW | 0.9998 | 0.7328 | 7 | 17 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-A74:03 | RLHHYQSVWR | 0.9913 | 0.9381 | 8 | 18 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-A74:09 | RLHHYQSVWR | 0.9913 | 0.9381 | 8 | 18 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-A74:11 | RLHHYQSVWR | 0.9913 | 0.9381 | 8 | 18 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B39:06 | HHYQSVWRRA | 0.9819 | 0.9669 | 10 | 20 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B39:24 | HHYQSVWRRAL | 0.9995 | 0.8325 | 10 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B39:01 | HHYQSVWRRAL | 0.9992 | 0.9398 | 10 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B39:06 | HHYQSVWRRAL | 0.999 | 0.9615 | 10 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B38:01 | HHYQSVWRRAL | 0.9979 | 0.9898 | 10 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B38:02 | HHYQSVWRRAL | 0.9977 | 0.9894 | 10 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-A74:09 | RLHHYQSVWRR | 0.9902 | 0.9503 | 8 | 19 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-A74:03 | RLHHYQSVWRR | 0.9902 | 0.9503 | 8 | 19 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-A74:11 | RLHHYQSVWRR | 0.9902 | 0.9503 | 8 | 19 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B15:10 | HHYQSVWRRAL | 0.9893 | 0.6589 | 10 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-A33:05 | HYQSVWRRALR | 0.9815 | 0.7071 | 11 | 22 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-A33:01 | HYQSVWRRALR | 0.9815 | 0.7071 | 11 | 22 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B14:01 | HHYQSVWRRAL | 0.9767 | 0.9546 | 10 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B14:02 | HHYQSVWRRAL | 0.9767 | 0.9546 | 10 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B15:18 | HHYQSVWRRAL | 0.9669 | 0.818 | 10 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-A31:02 | RLHHYQSVWRR | 0.9648 | 0.9439 | 8 | 19 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-A31:06 | RLHHYQSVWRR | 0.9511 | 0.8348 | 8 | 19 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-A31:02 | HYQSVWRRALR | 0.9344 | 0.9198 | 11 | 22 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B15:37 | HHYQSVWRRAL | 0.8405 | 0.7414 | 10 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B07:10 | HHYQSVWRRAL | 0.5359 | 0.7413 | 10 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B27:14 | GRLHHYQSV | 0.9998 | 0.8661 | 7 | 16 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B73:01 | GRLHHYQSV | 0.9974 | 0.9161 | 7 | 16 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B27:03 | GRLHHYQSV | 0.9919 | 0.9176 | 7 | 16 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B39:09 | YQSVWRRAL | 0.9844 | 0.8923 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-C07:05 | GRLHHYQSV | 0.984 | 0.9693 | 7 | 16 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-C12:12 | YQSVWRRAL | 0.9832 | 0.9704 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-C06:03 | YQSVWRRAL | 0.9793 | 0.9967 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B39:12 | YQSVWRRAL | 0.979 | 0.9695 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-C07:27 | GRLHHYQSV | 0.9742 | 0.9622 | 7 | 16 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B39:12 | GRLHHYQSV | 0.9645 | 0.9049 | 7 | 16 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B15:04 | YQSVWRRAL | 0.9469 | 0.9477 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-C07:13 | YQSVWRRAL | 0.9357 | 0.9599 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B48:03 | YQSVWRRAL | 0.8991 | 0.5291 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-C07:29 | YQSVWRRAL | 0.8867 | 0.9536 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B14:03 | YQSVWRRAL | 0.7789 | 0.888 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-C12:16 | YQSVWRRAL | 0.6697 | 0.9785 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-C12:16 | GRLHHYQSV | 0.058 | 0.9599 | 7 | 16 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B73:01 | HHYQSVWRRA | 0.8099 | 0.9534 | 10 | 20 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B39:09 | HHYQSVWRRAL | 0.9993 | 0.953 | 10 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B39:12 | HHYQSVWRRAL | 0.999 | 0.9438 | 10 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B39:05 | HHYQSVWRRAL | 0.9978 | 0.9358 | 10 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-A31:01 | RLHHYQSVWRR | 0.9913 | 0.9392 | 8 | 19 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-A33:03 | HYQSVWRRALR | 0.9713 | 0.7043 | 11 | 22 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B14:03 | HHYQSVWRRAL | 0.8582 | 0.9252 | 10 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B27:08 | GRLHHYQSV | 0.9998 | 0.842 | 7 | 16 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B27:10 | GRLHHYQSV | 0.9998 | 0.9454 | 7 | 16 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B27:09 | GRLHHYQSV | 0.9998 | 0.8756 | 7 | 16 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B27:06 | GRLHHYQSV | 0.9998 | 0.8929 | 7 | 16 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B57:10 | RLHHYQSVW | 0.9966 | 0.9951 | 8 | 17 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-A32:01 | RLHHYQSVW | 0.9957 | 0.9944 | 8 | 17 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B57:04 | RLHHYQSVW | 0.9922 | 0.9364 | 8 | 17 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B58:06 | RLHHYQSVW | 0.9922 | 0.9863 | 8 | 17 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B39:31 | YQSVWRRAL | 0.9833 | 0.9674 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B39:02 | YQSVWRRAL | 0.983 | 0.9842 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-C06:08 | GRLHHYQSV | 0.9779 | 0.9926 | 7 | 16 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-C12:03 | YQSVWRRAL | 0.9694 | 0.9918 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-C07:01 | GRLHHYQSV | 0.9684 | 0.8142 | 7 | 16 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-C03:05 | YQSVWRRAL | 0.952 | 0.9222 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B15:24 | RLHHYQSVW | 0.9448 | 0.9928 | 8 | 17 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-C03:67 | YQSVWRRAL | 0.9381 | 0.9749 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-C06:02 | YQSVWRRAL | 0.9315 | 0.9969 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-C06:17 | YQSVWRRAL | 0.9315 | 0.9969 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-C07:04 | YQSVWRRAL | 0.9143 | 0.9563 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-C06:08 | YQSVWRRAL | 0.9004 | 0.9962 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B40:12 | YQSVWRRAL | 0.8991 | 0.5291 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B15:13 | RLHHYQSVW | 0.8693 | 0.9842 | 8 | 17 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B15:73 | YQSVWRRAL | 0.8469 | 0.9514 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-C07:04 | GRLHHYQSV | 0.8352 | 0.9762 | 7 | 16 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-C12:02 | YQSVWRRAL | 0.8125 | 0.9824 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B15:68 | YQSVWRRAL | 0.8047 | 0.7343 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B15:30 | YQSVWRRAL | 0.7836 | 0.9587 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-C06:06 | YQSVWRRAL | 0.7596 | 0.9954 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-C07:22 | GRLHHYQSV | 0.7262 | 0.7815 | 7 | 16 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B40:21 | YQSVWRRAL | 0.7163 | 0.5511 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B15:09 | YQSVWRRAL | 0.5332 | 0.7994 | 12 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-C06:02 | GRLHHYQSV | 0.3199 | 0.9911 | 7 | 16 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-C06:17 | GRLHHYQSV | 0.3199 | 0.9911 | 7 | 16 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-A74:01 | RLHHYQSVWR | 0.9913 | 0.9381 | 8 | 18 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-C14:02 | HYQSVWRRAL | 0.768 | 0.9868 | 11 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-C14:03 | HYQSVWRRAL | 0.768 | 0.9868 | 11 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B39:31 | HHYQSVWRRAL | 0.9993 | 0.9414 | 10 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B38:05 | HHYQSVWRRAL | 0.9979 | 0.9898 | 10 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-A74:01 | RLHHYQSVWRR | 0.9902 | 0.9503 | 8 | 19 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B15:09 | HHYQSVWRRAL | 0.9807 | 0.7875 | 10 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | HLA-B39:11 | HHYQSVWRRAL | 0.8742 | 0.8951 | 10 | 21 |
Top |
Potential FusionNeoAntigen Information of HERC1-DAPK2 in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| HERC1-DAPK2_63988323_64263760.msa |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | DRB1-1510 | ESGRLHHYQSVWRRA | 5 | 20 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | DRB1-1510 | SGRLHHYQSVWRRAL | 6 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | DRB5-0106 | ESGRLHHYQSVWRRA | 5 | 20 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | DRB5-0106 | SGRLHHYQSVWRRAL | 6 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | DRB5-0106 | GESGRLHHYQSVWRR | 4 | 19 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | DRB5-0202 | ESGRLHHYQSVWRRA | 5 | 20 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | DRB5-0202 | SGRLHHYQSVWRRAL | 6 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | DRB5-0202 | GESGRLHHYQSVWRR | 4 | 19 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | DRB5-0202 | GRLHHYQSVWRRALR | 7 | 22 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | DRB5-0203 | ESGRLHHYQSVWRRA | 5 | 20 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | DRB5-0203 | SGRLHHYQSVWRRAL | 6 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | DRB5-0204 | ESGRLHHYQSVWRRA | 5 | 20 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | DRB5-0204 | SGRLHHYQSVWRRAL | 6 | 21 |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 | DRB5-0205 | ESGRLHHYQSVWRRA | 5 | 20 |
Top |
Fusion breakpoint peptide structures of HERC1-DAPK2 |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 8604 | SGRLHHYQSVWRRA | HERC1 | DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5209 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of HERC1-DAPK2 |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 8604 | SGRLHHYQSVWRRA | -6.69561 | -6.80901 |
| HLA-B14:02 | 3BVN | 8604 | SGRLHHYQSVWRRA | -4.57314 | -5.60844 |
| HLA-B52:01 | 3W39 | 8604 | SGRLHHYQSVWRRA | -8.26982 | -8.38322 |
| HLA-B52:01 | 3W39 | 8604 | SGRLHHYQSVWRRA | -4.20619 | -5.24149 |
| HLA-A11:01 | 4UQ2 | 8604 | SGRLHHYQSVWRRA | -6.38936 | -6.50276 |
| HLA-A11:01 | 4UQ2 | 8604 | SGRLHHYQSVWRRA | -5.4102 | -6.4455 |
| HLA-A24:02 | 5HGA | 8604 | SGRLHHYQSVWRRA | -7.10684 | -7.22024 |
| HLA-A24:02 | 5HGA | 8604 | SGRLHHYQSVWRRA | -5.37582 | -6.41112 |
| HLA-B44:05 | 3DX8 | 8604 | SGRLHHYQSVWRRA | -5.61918 | -5.73258 |
| HLA-B44:05 | 3DX8 | 8604 | SGRLHHYQSVWRRA | -4.56468 | -5.59998 |
Top |
Vaccine Design for the FusionNeoAntigens of HERC1-DAPK2 |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 10 | 19 | HHYQSVWRR | CACTATCAGAGTGTCTGGAGGAGAGCT |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 10 | 20 | HHYQSVWRRA | CACTATCAGAGTGTCTGGAGGAGAGCTCTT |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 10 | 21 | HHYQSVWRRAL | CACTATCAGAGTGTCTGGAGGAGAGCTCTTCGA |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 11 | 19 | HYQSVWRR | TATCAGAGTGTCTGGAGGAGAGCT |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 11 | 21 | HYQSVWRRAL | TATCAGAGTGTCTGGAGGAGAGCTCTTCGA |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 11 | 22 | HYQSVWRRALR | TATCAGAGTGTCTGGAGGAGAGCTCTTCGATTT |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 12 | 21 | YQSVWRRAL | CAGAGTGTCTGGAGGAGAGCTCTTCGA |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 7 | 16 | GRLHHYQSV | CGATTGCATCACTATCAGAGTGTCTGG |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 7 | 17 | GRLHHYQSVW | CGATTGCATCACTATCAGAGTGTCTGGAGG |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 8 | 17 | RLHHYQSVW | TTGCATCACTATCAGAGTGTCTGGAGG |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 8 | 18 | RLHHYQSVWR | TTGCATCACTATCAGAGTGTCTGGAGGAGA |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 8 | 19 | RLHHYQSVWRR | TTGCATCACTATCAGAGTGTCTGGAGGAGAGCT |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 4 | 19 | GESGRLHHYQSVWRR | GAGAGTGGCCGATTGCATCACTATCAGAGTGTCTGGAGGAGAGCT |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 5 | 20 | ESGRLHHYQSVWRRA | AGTGGCCGATTGCATCACTATCAGAGTGTCTGGAGGAGAGCTCTT |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 6 | 21 | SGRLHHYQSVWRRAL | GGCCGATTGCATCACTATCAGAGTGTCTGGAGGAGAGCTCTTCGA |
| HERC1-DAPK2 | chr15 | 63988323 | chr15 | 64263760 | 7 | 22 | GRLHHYQSVWRRALR | CGATTGCATCACTATCAGAGTGTCTGGAGGAGAGCTCTTCGATTT |
Top |
Information of the samples that have these potential fusion neoantigens of HERC1-DAPK2 |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| STAD | HERC1-DAPK2 | chr15 | 63988323 | ENST00000443617 | chr15 | 64263760 | ENST00000261891 | TCGA-VQ-A8E2-01A |
Top |
Potential target of CAR-T therapy development for HERC1-DAPK2 |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to HERC1-DAPK2 |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to HERC1-DAPK2 |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies