|
Fusion Protein:HIF1A-SF3B1 |
Fusion Gene and Fusion Protein Summary |
Fusion gene summary |
Fusion partner gene information | Fusion gene name: HIF1A-SF3B1 | FusionPDB ID: 36347 | FusionGDB2.0 ID: 36347 | Hgene | Tgene | Gene symbol | HIF1A | SF3B1 | Gene ID | 3091 | 23451 |
Gene name | hypoxia inducible factor 1 subunit alpha | splicing factor 3b subunit 1 | |
Synonyms | HIF-1-alpha|HIF-1A|HIF-1alpha|HIF1|HIF1-ALPHA|MOP1|PASD8|bHLHe78 | Hsh155|MDS|PRP10|PRPF10|SAP155|SF3b155 | |
Cytomap | 14q23.2 | 2q33.1 | |
Type of gene | protein-coding | protein-coding | |
Description | hypoxia-inducible factor 1-alphaARNT interacting proteinPAS domain-containing protein 8basic-helix-loop-helix-PAS protein MOP1class E basic helix-loop-helix protein 78hypoxia inducible factor 1 alpha subunithypoxia inducible factor 1, alpha subunit | splicing factor 3B subunit 1pre-mRNA processing 10pre-mRNA splicing factor SF3b, 155 kDa subunitspliceosome-associated protein 155splicing factor 3b, subunit 1, 155kDa | |
Modification date | 20200329 | 20200329 | |
UniProtAcc | Q9NWT6 Main function of 5'-partner protein: FUNCTION: Hydroxylates HIF-1 alpha at 'Asn-803' in the C-terminal transactivation domain (CAD). Functions as an oxygen sensor and, under normoxic conditions, the hydroxylation prevents interaction of HIF-1 with transcriptional coactivators including Cbp/p300-interacting transactivator. Involved in transcriptional repression through interaction with HIF1A, VHL and histone deacetylases. Hydroxylates specific Asn residues within ankyrin repeat domains (ARD) of NFKB1, NFKBIA, NOTCH1, ASB4, PPP1R12A and several other ARD-containing proteins. Also hydroxylates Asp and His residues within ARDs of ANK1 and TNKS2, respectively. Negatively regulates NOTCH1 activity, accelerating myogenic differentiation. Positively regulates ASB4 activity, promoting vascular differentiation. {ECO:0000269|PubMed:12042299, ECO:0000269|PubMed:12080085, ECO:0000269|PubMed:17003112, ECO:0000269|PubMed:17573339, ECO:0000269|PubMed:18299578, ECO:0000269|PubMed:19245366, ECO:0000269|PubMed:21177872, ECO:0000269|PubMed:21251231}. | . | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000323441, ENST00000337138, ENST00000394997, ENST00000539097, ENST00000557538, ENST00000557206, | ENST00000409915, ENST00000414963, ENST00000462613, ENST00000487698, ENST00000335508, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 14 X 11 X 10=1540 | 6 X 8 X 4=192 |
# samples | 24 | 9 | |
** MAII score | log2(24/1540*10)=-2.68182403997375 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(9/192*10)=-1.09310940439148 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: HIF1A [Title/Abstract] AND SF3B1 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: HIF1A [Title/Abstract] AND SF3B1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | HIF1A(62203827)-SF3B1(198283312), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | HIF1A-SF3B1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. HIF1A-SF3B1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. HIF1A-SF3B1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. HIF1A-SF3B1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | HIF1A | GO:0001666 | response to hypoxia | 8756616|9887100|11782478|15261140|18419598 |
Hgene | HIF1A | GO:0006355 | regulation of transcription, DNA-templated | 11782478|15261140 |
Hgene | HIF1A | GO:0010468 | regulation of gene expression | 18419598 |
Hgene | HIF1A | GO:0010573 | vascular endothelial growth factor production | 12958148 |
Hgene | HIF1A | GO:0010575 | positive regulation of vascular endothelial growth factor production | 8756616 |
Hgene | HIF1A | GO:0010628 | positive regulation of gene expression | 15459207|24244340 |
Hgene | HIF1A | GO:0032364 | oxygen homeostasis | 16956324 |
Hgene | HIF1A | GO:0043619 | regulation of transcription from RNA polymerase II promoter in response to oxidative stress | 8089148|8387214 |
Hgene | HIF1A | GO:0045893 | positive regulation of transcription, DNA-templated | 8089148|9887100|25043030 |
Hgene | HIF1A | GO:0045944 | positive regulation of transcription by RNA polymerase II | 11573933 |
Hgene | HIF1A | GO:0046886 | positive regulation of hormone biosynthetic process | 1448077 |
Hgene | HIF1A | GO:0061419 | positive regulation of transcription from RNA polymerase II promoter in response to hypoxia | 22735262 |
Hgene | HIF1A | GO:0071456 | cellular response to hypoxia | 11573933|19528298|20889502 |
Hgene | HIF1A | GO:1902895 | positive regulation of pri-miRNA transcription by RNA polymerase II | 19782034 |
Hgene | HIF1A | GO:1903377 | negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway | 24899725 |
Tgene | SF3B1 | GO:0000398 | mRNA splicing, via spliceosome | 11252167|28781166|29360106 |
Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr14:62203827/chr2:198283312) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
Fusion gene breakpoints across HIF1A (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
Fusion gene breakpoints across SF3B1 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
Top |
Fusion Amino Acid Sequences |
Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000394997 | HIF1A | chr14 | 62203827 | + | ENST00000335508 | SF3B1 | chr2 | 198283312 | - | 7536 | 1517 | 265 | 5016 | 1583 |
ENST00000337138 | HIF1A | chr14 | 62203827 | + | ENST00000335508 | SF3B1 | chr2 | 198283312 | - | 7533 | 1514 | 265 | 5013 | 1582 |
ENST00000323441 | HIF1A | chr14 | 62203827 | + | ENST00000335508 | SF3B1 | chr2 | 198283312 | - | 7296 | 1277 | 28 | 4776 | 1582 |
ENST00000557538 | HIF1A | chr14 | 62203827 | + | ENST00000335508 | SF3B1 | chr2 | 198283312 | - | 7569 | 1550 | 229 | 5049 | 1606 |
ENST00000539097 | HIF1A | chr14 | 62203827 | + | ENST00000335508 | SF3B1 | chr2 | 198283312 | - | 7569 | 1550 | 229 | 5049 | 1606 |
DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000394997 | ENST00000335508 | HIF1A | chr14 | 62203827 | + | SF3B1 | chr2 | 198283312 | - | 0.000149259 | 0.99985075 |
ENST00000337138 | ENST00000335508 | HIF1A | chr14 | 62203827 | + | SF3B1 | chr2 | 198283312 | - | 0.000149886 | 0.99985003 |
ENST00000323441 | ENST00000335508 | HIF1A | chr14 | 62203827 | + | SF3B1 | chr2 | 198283312 | - | 0.000116203 | 0.9998838 |
ENST00000557538 | ENST00000335508 | HIF1A | chr14 | 62203827 | + | SF3B1 | chr2 | 198283312 | - | 0.000127114 | 0.9998729 |
ENST00000539097 | ENST00000335508 | HIF1A | chr14 | 62203827 | + | SF3B1 | chr2 | 198283312 | - | 0.000127114 | 0.9998729 |
Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for HIF1A-SF3B1 |
+/-13 AA sequence from the breakpoints of the fusion protein sequences. |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
HIF1A | chr14 | 62203827 | SF3B1 | chr2 | 198283312 | 1277 | 410 | TLLAPAAGDTIISLDFGSNGGKTPDP |
HIF1A | chr14 | 62203827 | SF3B1 | chr2 | 198283312 | 1514 | 410 | TLLAPAAGDTIISLDFGSNGGKTPDP |
HIF1A | chr14 | 62203827 | SF3B1 | chr2 | 198283312 | 1517 | 411 | TLLAPAAGDTIISLDFGSNGGKTPDP |
HIF1A | chr14 | 62203827 | SF3B1 | chr2 | 198283312 | 1550 | 434 | TLLAPAAGDTIISLDFGSNGGKTPDP |
Top |
Potential FusionNeoAntigen Information of HIF1A-SF3B1 in HLA I |
Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
HIF1A-SF3B1_62203827_198283312.msa |
Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-B35:03 | AAGDTIISL | 0.9423 | 0.8847 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-B35:02 | AAGDTIISL | 0.8527 | 0.8796 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-B35:04 | AAGDTIISL | 0.8527 | 0.8796 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-B13:01 | AAGDTIISL | 0.2563 | 0.847 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-B35:03 | APAAGDTIISL | 0.9904 | 0.7091 | 3 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-B35:04 | APAAGDTIISL | 0.976 | 0.7659 | 3 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-B35:02 | APAAGDTIISL | 0.976 | 0.7659 | 3 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C05:09 | AGDTIISL | 1 | 0.7566 | 6 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C08:15 | AGDTIISL | 1 | 0.8142 | 6 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C08:04 | AGDTIISL | 0.9971 | 0.8712 | 6 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C08:13 | AGDTIISL | 0.9971 | 0.8712 | 6 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C08:03 | AGDTIISL | 0.912 | 0.8958 | 6 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C03:07 | AAGDTIISL | 0.9996 | 0.9804 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C03:19 | AAGDTIISL | 0.9995 | 0.9812 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C03:08 | AAGDTIISL | 0.9994 | 0.9104 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C15:06 | AAGDTIISL | 0.9994 | 0.9222 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C15:04 | AAGDTIISL | 0.9994 | 0.9384 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C05:09 | AAGDTIISL | 0.9991 | 0.8191 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C04:06 | AAGDTIISL | 0.9982 | 0.679 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C08:15 | AAGDTIISL | 0.9974 | 0.8582 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C08:13 | AAGDTIISL | 0.9942 | 0.9015 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C08:04 | AAGDTIISL | 0.9942 | 0.9015 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C01:17 | AAGDTIISL | 0.9929 | 0.9305 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C06:03 | AAGDTIISL | 0.9877 | 0.9886 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C12:12 | AAGDTIISL | 0.9854 | 0.8911 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C12:04 | AAGDTIISL | 0.9851 | 0.9872 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C03:14 | AAGDTIISL | 0.9225 | 0.9785 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C08:03 | AAGDTIISL | 0.9018 | 0.9145 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C02:06 | AAGDTIISL | 0.8763 | 0.9475 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-B35:12 | AAGDTIISL | 0.8527 | 0.8796 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C07:13 | AAGDTIISL | 0.8524 | 0.9181 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C01:30 | AAGDTIISL | 0.8409 | 0.9167 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-B42:02 | APAAGDTIISL | 0.9851 | 0.5611 | 3 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-B35:12 | APAAGDTIISL | 0.976 | 0.7659 | 3 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-B42:01 | APAAGDTIISL | 0.9737 | 0.5555 | 3 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-B39:10 | APAAGDTIISL | 0.9673 | 0.697 | 3 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C05:01 | AGDTIISL | 1 | 0.7566 | 6 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C04:03 | AGDTIISL | 1 | 0.6578 | 6 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C08:02 | AGDTIISL | 1 | 0.8142 | 6 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C08:01 | AGDTIISL | 0.912 | 0.8958 | 6 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-B07:13 | AGDTIISL | 0.5275 | 0.6797 | 6 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C03:04 | AAGDTIISL | 0.9996 | 0.9841 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C03:03 | AAGDTIISL | 0.9996 | 0.9841 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C15:09 | AAGDTIISL | 0.9994 | 0.9384 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C03:67 | AAGDTIISL | 0.9993 | 0.9731 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C15:05 | AAGDTIISL | 0.9992 | 0.9334 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C15:02 | AAGDTIISL | 0.9992 | 0.8979 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C05:01 | AAGDTIISL | 0.9991 | 0.8191 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C03:17 | AAGDTIISL | 0.9991 | 0.9604 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C04:03 | AAGDTIISL | 0.999 | 0.7087 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C03:05 | AAGDTIISL | 0.999 | 0.9086 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C03:02 | AAGDTIISL | 0.9982 | 0.9583 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C08:02 | AAGDTIISL | 0.9974 | 0.8582 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C01:03 | AAGDTIISL | 0.9966 | 0.8916 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C03:06 | AAGDTIISL | 0.9955 | 0.9847 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C01:02 | AAGDTIISL | 0.9938 | 0.9251 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C12:03 | AAGDTIISL | 0.9924 | 0.9601 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C16:04 | AAGDTIISL | 0.9859 | 0.9562 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C12:02 | AAGDTIISL | 0.979 | 0.9394 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C16:02 | AAGDTIISL | 0.9766 | 0.9915 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C16:01 | AAGDTIISL | 0.9618 | 0.9594 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-B35:13 | AAGDTIISL | 0.9398 | 0.8943 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C08:01 | AAGDTIISL | 0.9018 | 0.9145 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C07:04 | AAGDTIISL | 0.8971 | 0.8972 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-B35:09 | AAGDTIISL | 0.8527 | 0.8796 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C02:10 | AAGDTIISL | 0.806 | 0.9686 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C02:02 | AAGDTIISL | 0.806 | 0.9686 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-C17:01 | AAGDTIISL | 0.797 | 0.863 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-B15:30 | AAGDTIISL | 0.6563 | 0.7919 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-B07:13 | AAGDTIISL | 0.4049 | 0.7422 | 5 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-B35:13 | APAAGDTIISL | 0.9847 | 0.7172 | 3 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-B35:09 | APAAGDTIISL | 0.976 | 0.7659 | 3 | 14 |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 | HLA-B67:01 | APAAGDTIISL | 0.976 | 0.5661 | 3 | 14 |
Top |
Potential FusionNeoAntigen Information of HIF1A-SF3B1 in HLA II |
Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of HIF1A-SF3B1 |
3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
217 | AGDTIISLDFGSNG | HIF1A | SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 1277 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of HIF1A-SF3B1 |
Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 217 | AGDTIISLDFGSNG | -6.7759 | -6.8893 |
HLA-B14:02 | 3BVN | 217 | AGDTIISLDFGSNG | -4.69541 | -5.73071 |
HLA-B52:01 | 3W39 | 217 | AGDTIISLDFGSNG | -7.29079 | -7.40419 |
HLA-B52:01 | 3W39 | 217 | AGDTIISLDFGSNG | -4.68863 | -5.72393 |
HLA-A24:02 | 5HGA | 217 | AGDTIISLDFGSNG | -6.91369 | -7.94899 |
HLA-A24:02 | 5HGA | 217 | AGDTIISLDFGSNG | -5.33553 | -5.44893 |
HLA-B44:05 | 3DX8 | 217 | AGDTIISLDFGSNG | -8.15615 | -8.26955 |
HLA-B44:05 | 3DX8 | 217 | AGDTIISLDFGSNG | -4.08952 | -5.12482 |
Top |
Vaccine Design for the FusionNeoAntigens of HIF1A-SF3B1 |
mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 3 | 14 | APAAGDTIISL | CAATCATATCTTTAGATTTTGGCAGCAACGGAG |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 5 | 14 | AAGDTIISL | TATCTTTAGATTTTGGCAGCAACGGAG |
HIF1A-SF3B1 | chr14 | 62203827 | chr2 | 198283312 | 6 | 14 | AGDTIISL | CTTTAGATTTTGGCAGCAACGGAG |
mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of HIF1A-SF3B1 |
These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
Non-Cancer | HIF1A-SF3B1 | chr14 | 62203827 | ENST00000323441 | chr2 | 198283312 | ENST00000335508 | ERR315469 |
Top |
Potential target of CAR-T therapy development for HIF1A-SF3B1 |
Predicted 3D structure. We used RoseTTAFold. |
Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to HIF1A-SF3B1 |
Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to HIF1A-SF3B1 |
Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
Diseases associated with fusion partners. (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |