Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:HMGA2-VMP1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: HMGA2-VMP1
	FusionPDB ID: 36859
	FusionGDB2.0 ID: 36859
		Hgene	Tgene
	Gene symbol	HMGA2	VMP1
	Gene ID	8091	81671
	Gene name	high mobility group AT-hook 2	vacuole membrane protein 1
	Synonyms	BABL\|HMGI-C\|HMGIC\|LIPO\|STQTL9	EPG3\|TANGO5\|TMEM49
	Cytomap	12q14.3	17q23.1
	Type of gene	protein-coding	protein-coding
	Description	high mobility group protein HMGI-CHMGA2/KRT121P fusionhigh-mobility group (nonhistone chromosomal) protein isoform I-C	vacuole membrane protein 1ectopic P-granules autophagy protein 3 homologtransmembrane protein 49transport and golgi organization 5 homolog
	Modification date	20200329	20200327
	UniProtAcc	P52926 Main function of 5'-partner protein: FUNCTION: Functions as a transcriptional regulator. Functions in cell cycle regulation through CCNA2. Plays an important role in chromosome condensation during the meiotic G2/M transition of spermatocytes. Plays a role in postnatal myogenesis, is involved in satellite cell activation (By similarity). Positively regulates IGF2 expression through PLAG1 and in a PLAG1-independent manner (PubMed:28796236). {ECO:0000250\|UniProtKB:P52927, ECO:0000269\|PubMed:14645522, ECO:0000269\|PubMed:28796236}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000354636, ENST00000393577, ENST00000393578, ENST00000403681, ENST00000425208, ENST00000536545, ENST00000541363,	ENST00000588617, ENST00000262291, ENST00000536180, ENST00000537567, ENST00000539763, ENST00000545362,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	43 X 25 X 15=16125	42 X 34 X 19=27132
	# samples	43	151
	** MAII score	log2(43/16125*10)=-5.22881869049588 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(151/27132*10)=-4.16737494326024 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: HMGA2 [Title/Abstract] AND VMP1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: HMGA2 [Title/Abstract] AND VMP1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	HMGA2(66232349)-VMP1(57886156), # samples:1
Anticipated loss of major functional domain due to fusion event.	HMGA2-VMP1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. HMGA2-VMP1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. HMGA2-VMP1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. HMGA2-VMP1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	HMGA2	GO:0000122	negative regulation of transcription by RNA polymerase II	14627817
Hgene	HMGA2	GO:0002062	chondrocyte differentiation	21484705
Hgene	HMGA2	GO:0006284	base-excision repair	19465398
Hgene	HMGA2	GO:0007095	mitotic G2 DNA damage checkpoint	16061642
Hgene	HMGA2	GO:0010564	regulation of cell cycle process	14645522
Hgene	HMGA2	GO:0010628	positive regulation of gene expression	18832382
Hgene	HMGA2	GO:0031052	chromosome breakage	19549901
Hgene	HMGA2	GO:0031507	heterochromatin assembly	16901784
Hgene	HMGA2	GO:0035978	histone H2A-S139 phosphorylation	16061642
Hgene	HMGA2	GO:0035986	senescence-associated heterochromatin focus assembly	16901784
Hgene	HMGA2	GO:0035988	chondrocyte proliferation	21484705
Hgene	HMGA2	GO:0042769	DNA damage response, detection of DNA damage	19465398
Hgene	HMGA2	GO:0043065	positive regulation of apoptotic process	16061642
Hgene	HMGA2	GO:0043066	negative regulation of apoptotic process	19465398
Hgene	HMGA2	GO:0043392	negative regulation of DNA binding	14645522
Hgene	HMGA2	GO:0043922	negative regulation by host of viral transcription	17005673
Hgene	HMGA2	GO:0045869	negative regulation of single stranded viral RNA replication via double stranded DNA intermediate	17005673
Hgene	HMGA2	GO:0045892	negative regulation of transcription, DNA-templated	18832382
Hgene	HMGA2	GO:0045893	positive regulation of transcription, DNA-templated	15225648\|15755872\|17005673\|17324944\|17426251
Hgene	HMGA2	GO:0045944	positive regulation of transcription by RNA polymerase II	14645522\|18832382
Hgene	HMGA2	GO:0071158	positive regulation of cell cycle arrest	16061642
Hgene	HMGA2	GO:0071902	positive regulation of protein serine/threonine kinase activity	19549901
Hgene	HMGA2	GO:0090402	oncogene-induced cell senescence	16901784
Hgene	HMGA2	GO:2000648	positive regulation of stem cell proliferation	21484705
Hgene	HMGA2	GO:2000679	positive regulation of transcription regulatory region DNA binding	18832382
Hgene	HMGA2	GO:2000685	positive regulation of cellular response to X-ray	16061642
Hgene	HMGA2	GO:2001022	positive regulation of response to DNA damage stimulus	16061642\|19465398
Hgene	HMGA2	GO:2001033	negative regulation of double-strand break repair via nonhomologous end joining	19549901
Hgene	HMGA2	GO:2001038	regulation of cellular response to drug	16061642

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr12:66232349/chr17:57886156)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across HMGA2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across VMP1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000403681	HMGA2	chr12	66232349	+	ENST00000262291	VMP1	chr17	57886156	+	3077	1389	114	992	292
ENST00000403681	HMGA2	chr12	66232349	+	ENST00000537567	VMP1	chr17	57886156	+	2156	1389	114	992	292
ENST00000403681	HMGA2	chr12	66232349	+	ENST00000539763	VMP1	chr17	57886156	+	2116	1389	114	992	292
ENST00000403681	HMGA2	chr12	66232349	+	ENST00000536180	VMP1	chr17	57886156	+	1988	1389	114	992	292
ENST00000403681	HMGA2	chr12	66232349	+	ENST00000545362	VMP1	chr17	57886156	+	2148	1389	114	992	292
ENST00000541363	HMGA2	chr12	66232349	+	ENST00000262291	VMP1	chr17	57886156	+	2310	622	373	1128	251
ENST00000541363	HMGA2	chr12	66232349	+	ENST00000537567	VMP1	chr17	57886156	+	1389	622	373	1128	251
ENST00000541363	HMGA2	chr12	66232349	+	ENST00000539763	VMP1	chr17	57886156	+	1349	622	373	1128	251
ENST00000541363	HMGA2	chr12	66232349	+	ENST00000536180	VMP1	chr17	57886156	+	1221	622	373	1128	251
ENST00000541363	HMGA2	chr12	66232349	+	ENST00000545362	VMP1	chr17	57886156	+	1381	622	373	1128	251
ENST00000393577	HMGA2	chr12	66232349	+	ENST00000262291	VMP1	chr17	57886156	+	2085	397	148	903	251
ENST00000393577	HMGA2	chr12	66232349	+	ENST00000537567	VMP1	chr17	57886156	+	1164	397	148	903	251
ENST00000393577	HMGA2	chr12	66232349	+	ENST00000539763	VMP1	chr17	57886156	+	1124	397	148	903	251
ENST00000393577	HMGA2	chr12	66232349	+	ENST00000536180	VMP1	chr17	57886156	+	996	397	148	903	251
ENST00000393577	HMGA2	chr12	66232349	+	ENST00000545362	VMP1	chr17	57886156	+	1156	397	148	903	251
ENST00000393578	HMGA2	chr12	66232349	+	ENST00000262291	VMP1	chr17	57886156	+	2748	1060	811	1566	251
ENST00000393578	HMGA2	chr12	66232349	+	ENST00000537567	VMP1	chr17	57886156	+	1827	1060	811	1566	251
ENST00000393578	HMGA2	chr12	66232349	+	ENST00000539763	VMP1	chr17	57886156	+	1787	1060	811	1566	251
ENST00000393578	HMGA2	chr12	66232349	+	ENST00000536180	VMP1	chr17	57886156	+	1659	1060	811	1566	251
ENST00000393578	HMGA2	chr12	66232349	+	ENST00000545362	VMP1	chr17	57886156	+	1819	1060	811	1566	251
ENST00000425208	HMGA2	chr12	66232349	+	ENST00000262291	VMP1	chr17	57886156	+	2748	1060	811	1566	251
ENST00000425208	HMGA2	chr12	66232349	+	ENST00000537567	VMP1	chr17	57886156	+	1827	1060	811	1566	251
ENST00000425208	HMGA2	chr12	66232349	+	ENST00000539763	VMP1	chr17	57886156	+	1787	1060	811	1566	251
ENST00000425208	HMGA2	chr12	66232349	+	ENST00000536180	VMP1	chr17	57886156	+	1659	1060	811	1566	251
ENST00000425208	HMGA2	chr12	66232349	+	ENST00000545362	VMP1	chr17	57886156	+	1819	1060	811	1566	251
ENST00000536545	HMGA2	chr12	66232349	+	ENST00000262291	VMP1	chr17	57886156	+	2748	1060	811	1566	251
ENST00000536545	HMGA2	chr12	66232349	+	ENST00000537567	VMP1	chr17	57886156	+	1827	1060	811	1566	251
ENST00000536545	HMGA2	chr12	66232349	+	ENST00000539763	VMP1	chr17	57886156	+	1787	1060	811	1566	251
ENST00000536545	HMGA2	chr12	66232349	+	ENST00000536180	VMP1	chr17	57886156	+	1659	1060	811	1566	251
ENST00000536545	HMGA2	chr12	66232349	+	ENST00000545362	VMP1	chr17	57886156	+	1819	1060	811	1566	251
ENST00000354636	HMGA2	chr12	66232349	+	ENST00000262291	VMP1	chr17	57886156	+	2748	1060	811	1566	251
ENST00000354636	HMGA2	chr12	66232349	+	ENST00000537567	VMP1	chr17	57886156	+	1827	1060	811	1566	251
ENST00000354636	HMGA2	chr12	66232349	+	ENST00000539763	VMP1	chr17	57886156	+	1787	1060	811	1566	251
ENST00000354636	HMGA2	chr12	66232349	+	ENST00000536180	VMP1	chr17	57886156	+	1659	1060	811	1566	251
ENST00000354636	HMGA2	chr12	66232349	+	ENST00000545362	VMP1	chr17	57886156	+	1819	1060	811	1566	251

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000403681	ENST00000262291	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.012096385	0.98790365
ENST00000403681	ENST00000537567	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.018889826	0.9811102
ENST00000403681	ENST00000539763	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.01923875	0.9807613
ENST00000403681	ENST00000536180	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.02194032	0.9780597
ENST00000403681	ENST00000545362	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.018966751	0.9810332
ENST00000541363	ENST00000262291	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.006949022	0.99305093
ENST00000541363	ENST00000537567	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.024719074	0.97528094
ENST00000541363	ENST00000539763	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.026630584	0.9733695
ENST00000541363	ENST00000536180	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.032654405	0.9673456
ENST00000541363	ENST00000545362	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.024784362	0.9752157
ENST00000393577	ENST00000262291	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.004068086	0.9959319
ENST00000393577	ENST00000537567	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.025679009	0.97432107
ENST00000393577	ENST00000539763	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.028605979	0.971394
ENST00000393577	ENST00000536180	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.035660297	0.96433973
ENST00000393577	ENST00000545362	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.026410349	0.97358966
ENST00000393578	ENST00000262291	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.00801823	0.9919818
ENST00000393578	ENST00000537567	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.01964101	0.98035896
ENST00000393578	ENST00000539763	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.020564973	0.97943497
ENST00000393578	ENST00000536180	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.021688472	0.9783115
ENST00000393578	ENST00000545362	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.019768164	0.98023176
ENST00000425208	ENST00000262291	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.00801823	0.9919818
ENST00000425208	ENST00000537567	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.01964101	0.98035896
ENST00000425208	ENST00000539763	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.020564973	0.97943497
ENST00000425208	ENST00000536180	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.021688472	0.9783115
ENST00000425208	ENST00000545362	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.019768164	0.98023176
ENST00000536545	ENST00000262291	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.00801823	0.9919818
ENST00000536545	ENST00000537567	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.01964101	0.98035896
ENST00000536545	ENST00000539763	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.020564973	0.97943497
ENST00000536545	ENST00000536180	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.021688472	0.9783115
ENST00000536545	ENST00000545362	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.019768164	0.98023176
ENST00000354636	ENST00000262291	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.00801823	0.9919818
ENST00000354636	ENST00000537567	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.01964101	0.98035896
ENST00000354636	ENST00000539763	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.020564973	0.97943497
ENST00000354636	ENST00000536180	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.021688472	0.9783115
ENST00000354636	ENST00000545362	HMGA2	chr12	66232349	+	VMP1	chr17	57886156	+	0.019768164	0.98023176

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for HMGA2-VMP1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
HMGA2	chr12	66232349	VMP1	chr17	57886156	1060	83	TGEKRPRGRPRKWDFASRAKLAVQKL
HMGA2	chr12	66232349	VMP1	chr17	57886156	397	83	TGEKRPRGRPRKWDFASRAKLAVQKL
HMGA2	chr12	66232349	VMP1	chr17	57886156	622	83	TGEKRPRGRPRKWDFASRAKLAVQKL

Top

Potential FusionNeoAntigen Information of HMGA2-VMP1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

HMGA2-VMP1_66232349_57886156.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	HLA-B07:02	RPRGRPRKWDF	0.9992	0.5178	4	15
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	HLA-C04:10	KWDFASRAKL	0.9912	0.8738	11	21
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	HLA-C04:07	KWDFASRAKL	0.9907	0.8668	11	21
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	HLA-C04:01	KWDFASRAKL	0.9907	0.8668	11	21
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	HLA-B07:09	RPRGRPRKWDF	0.9994	0.5121	4	15
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	HLA-B07:22	RPRGRPRKWDF	0.9992	0.5178	4	15

Top

Potential FusionNeoAntigen Information of HMGA2-VMP1 in HLA II

HMGA2-VMP1_66232349_57886156.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1111	RKWDFASRAKLAVQK	10	25
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1111	KWDFASRAKLAVQKL	11	26
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1114	RKWDFASRAKLAVQK	10	25
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1114	KWDFASRAKLAVQKL	11	26
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1120	RKWDFASRAKLAVQK	10	25
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1120	KWDFASRAKLAVQKL	11	26
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1145	RKWDFASRAKLAVQK	10	25
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1168	RKWDFASRAKLAVQK	10	25
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1302	RKWDFASRAKLAVQK	10	25
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1302	KWDFASRAKLAVQKL	11	26
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1323	RKWDFASRAKLAVQK	10	25
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1323	KWDFASRAKLAVQKL	11	26
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1329	RKWDFASRAKLAVQK	10	25
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1331	RKWDFASRAKLAVQK	10	25
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1331	PRKWDFASRAKLAVQ	9	24
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1334	RKWDFASRAKLAVQK	10	25
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1334	KWDFASRAKLAVQKL	11	26
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1336	RKWDFASRAKLAVQK	10	25
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1339	RKWDFASRAKLAVQK	10	25
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1339	KWDFASRAKLAVQKL	11	26
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1363	RKWDFASRAKLAVQK	10	25
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1363	KWDFASRAKLAVQKL	11	26
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1373	RKWDFASRAKLAVQK	10	25
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1373	KWDFASRAKLAVQKL	11	26
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1374	RKWDFASRAKLAVQK	10	25
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1374	KWDFASRAKLAVQKL	11	26
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1397	RKWDFASRAKLAVQK	10	25
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1397	KWDFASRAKLAVQKL	11	26
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1399	RKWDFASRAKLAVQK	10	25
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1399	KWDFASRAKLAVQKL	11	26
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1407	PRKWDFASRAKLAVQ	9	24
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1407	RPRKWDFASRAKLAV	8	23
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1407	GRPRKWDFASRAKLA	7	22
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1414	PRKWDFASRAKLAVQ	9	24
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1414	RPRKWDFASRAKLAV	8	23
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1414	GRPRKWDFASRAKLA	7	22
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1436	PRKWDFASRAKLAVQ	9	24
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1436	RPRKWDFASRAKLAV	8	23
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1436	GRPRKWDFASRAKLA	7	22
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1442	PRKWDFASRAKLAVQ	9	24
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1442	RPRKWDFASRAKLAV	8	23
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1442	GRPRKWDFASRAKLA	7	22
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1442	RKWDFASRAKLAVQK	10	25
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1444	PRKWDFASRAKLAVQ	9	24
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1444	RPRKWDFASRAKLAV	8	23
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1444	GRPRKWDFASRAKLA	7	22
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1451	PRKWDFASRAKLAVQ	9	24
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1468	PRKWDFASRAKLAVQ	9	24
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1468	RPRKWDFASRAKLAV	8	23
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1468	GRPRKWDFASRAKLA	7	22
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1493	PRKWDFASRAKLAVQ	9	24
HMGA2-VMP1	chr12	66232349	chr17	57886156	1060	DRB1-1493	RPRKWDFASRAKLAV	8	23

Top

Fusion breakpoint peptide structures of HMGA2-VMP1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7892	RGRPRKWDFASRAK	HMGA2	VMP1	chr12	66232349	chr17	57886156	1060

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of HMGA2-VMP1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	7892	RGRPRKWDFASRAK	-8.01054	-8.20734
HLA-B14:02	3BVN	7892	RGRPRKWDFASRAK	-5.69847	-6.44727
HLA-B52:01	3W39	7892	RGRPRKWDFASRAK	-7.37464	-7.57144
HLA-B52:01	3W39	7892	RGRPRKWDFASRAK	-5.95053	-6.69933
HLA-A11:01	4UQ2	7892	RGRPRKWDFASRAK	-9.09685	-9.29365
HLA-A24:02	5HGA	7892	RGRPRKWDFASRAK	-9.68463	-10.4334
HLA-A24:02	5HGA	7892	RGRPRKWDFASRAK	-5.62792	-5.82472
HLA-B44:05	3DX8	7892	RGRPRKWDFASRAK	-5.87163	-6.06843
HLA-B44:05	3DX8	7892	RGRPRKWDFASRAK	-3.82794	-4.57674

Top

Vaccine Design for the FusionNeoAntigens of HMGA2-VMP1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
HMGA2-VMP1	chr12	66232349	chr17	57886156	11	21	KWDFASRAKL	AAATGGGACTTTGCCTCCCGGGCCAAACTG
HMGA2-VMP1	chr12	66232349	chr17	57886156	4	15	RPRGRPRKWDF	CGGCCAAGAGGCAGACCTAGGAAATGGGACTTT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
HMGA2-VMP1	chr12	66232349	chr17	57886156	10	25	RKWDFASRAKLAVQK	AGGAAATGGGACTTTGCCTCCCGGGCCAAACTGGCAGTTCAAAAA
HMGA2-VMP1	chr12	66232349	chr17	57886156	11	26	KWDFASRAKLAVQKL	AAATGGGACTTTGCCTCCCGGGCCAAACTGGCAGTTCAAAAACTA
HMGA2-VMP1	chr12	66232349	chr17	57886156	7	22	GRPRKWDFASRAKLA	GGCAGACCTAGGAAATGGGACTTTGCCTCCCGGGCCAAACTGGCA
HMGA2-VMP1	chr12	66232349	chr17	57886156	8	23	RPRKWDFASRAKLAV	AGACCTAGGAAATGGGACTTTGCCTCCCGGGCCAAACTGGCAGTT
HMGA2-VMP1	chr12	66232349	chr17	57886156	9	24	PRKWDFASRAKLAVQ	CCTAGGAAATGGGACTTTGCCTCCCGGGCCAAACTGGCAGTTCAA

Top

Information of the samples that have these potential fusion neoantigens of HMGA2-VMP1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	HMGA2-VMP1	chr12	66232349	ENST00000354636	chr17	57886156	ENST00000262291	TCGA-BR-8080

Top

Potential target of CAR-T therapy development for HMGA2-VMP1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Tgene

VMP1

chr12:66232349

chr17:57886156

ENST00000262291

251_271

407.0

Transmembrane

Helical

Tgene

VMP1

chr12:66232349

chr17:57886156

ENST00000262291

274_294

407.0

Transmembrane

Helical

Tgene

VMP1

chr12:66232349

chr17:57886156

ENST00000262291

306_326

407.0

Transmembrane

Helical

Tgene

VMP1

chr12:66232349

chr17:57886156

ENST00000262291

364_384

407.0

Transmembrane

Helical

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to HMGA2-VMP1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to HMGA2-VMP1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Hgene	HMGA2	C1519176	Salivary Gland Pleomorphic Adenoma	2	ORPHANET
Hgene	HMGA2	C0005612	Birth Weight	1	CTD_human
Hgene	HMGA2	C0006826	Malignant Neoplasms	1	CTD_human
Hgene	HMGA2	C0027626	Neoplasm Invasiveness	1	CTD_human
Hgene	HMGA2	C0027651	Neoplasms	1	CTD_human
Hgene	HMGA2	C0086692	Benign Neoplasm	1	CTD_human
Hgene	HMGA2	C0175693	Russell-Silver syndrome	1	GENOMICS_ENGLAND
Hgene	HMGA2	C0473935	Radiolabeled somatostatin analog study	1	GENOMICS_ENGLAND
Hgene	HMGA2	C0796160	MENTAL RETARDATION, X-LINKED, SNYDER-ROBINSON TYPE	1	GENOMICS_ENGLAND
Hgene	HMGA2	C1096309	Myolipoma	1	GENOMICS_ENGLAND
Hgene	HMGA2	C4305140	12q14 microdeletion syndrome	1	ORPHANET

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)