|
|||||||
|
Fusion Protein:HNRNPH1-INSR |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: HNRNPH1-INSR | FusionPDB ID: 37194 | FusionGDB2.0 ID: 37194 | Hgene | Tgene | Gene symbol | HNRNPH1 | INSR | Gene ID | 3187 | 3643 |
| Gene name | heterogeneous nuclear ribonucleoprotein H1 | insulin receptor | |
| Synonyms | HNRPH|HNRPH1|hnRNPH | CD220|HHF5 | |
| Cytomap | 5q35.3 | 19p13.2 | |
| Type of gene | protein-coding | protein-coding | |
| Description | heterogeneous nuclear ribonucleoprotein Hepididymis secretory sperm binding proteinheterogeneous nuclear ribonucleoprotein H1 (H) | insulin receptorIR | |
| Modification date | 20200320 | 20200313 | |
| UniProtAcc | P31943 Main function of 5'-partner protein: FUNCTION: This protein is a component of the heterogeneous nuclear ribonucleoprotein (hnRNP) complexes which provide the substrate for the processing events that pre-mRNAs undergo before becoming functional, translatable mRNAs in the cytoplasm. Mediates pre-mRNA alternative splicing regulation. Inhibits, together with CUGBP1, insulin receptor (IR) pre-mRNA exon 11 inclusion in myoblast. Binds to the IR RNA. Binds poly(RG). {ECO:0000269|PubMed:11003644, ECO:0000269|PubMed:16946708}. | P06213 Main function of 5'-partner protein: FUNCTION: Receptor tyrosine kinase which mediates the pleiotropic actions of insulin. Binding of insulin leads to phosphorylation of several intracellular substrates, including, insulin receptor substrates (IRS1, 2, 3, 4), SHC, GAB1, CBL and other signaling intermediates. Each of these phosphorylated proteins serve as docking proteins for other signaling proteins that contain Src-homology-2 domains (SH2 domain) that specifically recognize different phosphotyrosine residues, including the p85 regulatory subunit of PI3K and SHP2. Phosphorylation of IRSs proteins lead to the activation of two main signaling pathways: the PI3K-AKT/PKB pathway, which is responsible for most of the metabolic actions of insulin, and the Ras-MAPK pathway, which regulates expression of some genes and cooperates with the PI3K pathway to control cell growth and differentiation. Binding of the SH2 domains of PI3K to phosphotyrosines on IRS1 leads to the activation of PI3K and the generation of phosphatidylinositol-(3, 4, 5)-triphosphate (PIP3), a lipid second messenger, which activates several PIP3-dependent serine/threonine kinases, such as PDPK1 and subsequently AKT/PKB. The net effect of this pathway is to produce a translocation of the glucose transporter SLC2A4/GLUT4 from cytoplasmic vesicles to the cell membrane to facilitate glucose transport. Moreover, upon insulin stimulation, activated AKT/PKB is responsible for: anti-apoptotic effect of insulin by inducing phosphorylation of BAD; regulates the expression of gluconeogenic and lipogenic enzymes by controlling the activity of the winged helix or forkhead (FOX) class of transcription factors. Another pathway regulated by PI3K-AKT/PKB activation is mTORC1 signaling pathway which regulates cell growth and metabolism and integrates signals from insulin. AKT mediates insulin-stimulated protein synthesis by phosphorylating TSC2 thereby activating mTORC1 pathway. The Ras/RAF/MAP2K/MAPK pathway is mainly involved in mediating cell growth, survival and cellular differentiation of insulin. Phosphorylated IRS1 recruits GRB2/SOS complex, which triggers the activation of the Ras/RAF/MAP2K/MAPK pathway. In addition to binding insulin, the insulin receptor can bind insulin-like growth factors (IGFI and IGFII). Isoform Short has a higher affinity for IGFII binding. When present in a hybrid receptor with IGF1R, binds IGF1. PubMed:12138094 shows that hybrid receptors composed of IGF1R and INSR isoform Long are activated with a high affinity by IGF1, with low affinity by IGF2 and not significantly activated by insulin, and that hybrid receptors composed of IGF1R and INSR isoform Short are activated by IGF1, IGF2 and insulin. In contrast, PubMed:16831875 shows that hybrid receptors composed of IGF1R and INSR isoform Long and hybrid receptors composed of IGF1R and INSR isoform Short have similar binding characteristics, both bind IGF1 and have a low affinity for insulin. In adipocytes, inhibits lipolysis (By similarity). {ECO:0000250|UniProtKB:P15208, ECO:0000269|PubMed:12138094, ECO:0000269|PubMed:16314505, ECO:0000269|PubMed:16831875, ECO:0000269|PubMed:8257688, ECO:0000269|PubMed:8276809, ECO:0000269|PubMed:8452530, ECO:0000269|PubMed:9428692}. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000393432, ENST00000329433, ENST00000356731, ENST00000442819, ENST00000510411, ENST00000511300, ENST00000524180, | ENST00000302850, ENST00000341500, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 21 X 18 X 8=3024 | 20 X 13 X 8=2080 |
| # samples | 21 | 20 | |
| ** MAII score | log2(21/3024*10)=-3.84799690655495 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(20/2080*10)=-3.37851162325373 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: HNRNPH1 [Title/Abstract] AND INSR [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: HNRNPH1 [Title/Abstract] AND INSR [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | HNRNPH1(179044985)-INSR(7184648), # samples:1 HNRNPH1(179044990)-INSR(7184648), # samples:1 | ||
| Anticipated loss of major functional domain due to fusion event. | HNRNPH1-INSR seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. HNRNPH1-INSR seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. HNRNPH1-INSR seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. HNRNPH1-INSR seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. HNRNPH1-INSR seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. HNRNPH1-INSR seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. HNRNPH1-INSR seems lost the major protein functional domain in Tgene partner, which is a kinase due to the frame-shifted ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | HNRNPH1 | GO:0043484 | regulation of RNA splicing | 16946708 |
| Tgene | INSR | GO:0001934 | positive regulation of protein phosphorylation | 7556070 |
| Tgene | INSR | GO:0002092 | positive regulation of receptor internalization | 25401701 |
| Tgene | INSR | GO:0007186 | G protein-coupled receptor signaling pathway | 9092559 |
| Tgene | INSR | GO:0008284 | positive regulation of cell proliferation | 17925406 |
| Tgene | INSR | GO:0008286 | insulin receptor signaling pathway | 6849137|8440175|20455999 |
| Tgene | INSR | GO:0018108 | peptidyl-tyrosine phosphorylation | 8496180 |
| Tgene | INSR | GO:0032148 | activation of protein kinase B activity | 7556070 |
| Tgene | INSR | GO:0032869 | cellular response to insulin stimulus | 8440175 |
| Tgene | INSR | GO:0043410 | positive regulation of MAPK cascade | 20455999 |
| Tgene | INSR | GO:0045725 | positive regulation of glycogen biosynthetic process | 17925406 |
| Tgene | INSR | GO:0046326 | positive regulation of glucose import | 3518947 |
| Tgene | INSR | GO:0046777 | protein autophosphorylation | 6849137|8496180 |
| Tgene | INSR | GO:0060267 | positive regulation of respiratory burst | 9092559 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr5:179044985/chr19:7184648) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across HNRNPH1 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across INSR (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000442819 | HNRNPH1 | chr5 | 179044985 | - | ENST00000341500 | INSR | chr19 | 7184648 | - | 9166 | 904 | 117 | 4364 | 1415 |
| ENST00000442819 | HNRNPH1 | chr5 | 179044985 | - | ENST00000302850 | INSR | chr19 | 7184648 | - | 4830 | 904 | 117 | 4400 | 1427 |
| ENST00000356731 | HNRNPH1 | chr5 | 179044985 | - | ENST00000341500 | INSR | chr19 | 7184648 | - | 10585 | 2323 | 1536 | 5783 | 1415 |
| ENST00000356731 | HNRNPH1 | chr5 | 179044985 | - | ENST00000302850 | INSR | chr19 | 7184648 | - | 6249 | 2323 | 1536 | 5819 | 1427 |
| ENST00000329433 | HNRNPH1 | chr5 | 179044985 | - | ENST00000341500 | INSR | chr19 | 7184648 | - | 9084 | 822 | 35 | 4282 | 1415 |
| ENST00000329433 | HNRNPH1 | chr5 | 179044985 | - | ENST00000302850 | INSR | chr19 | 7184648 | - | 4748 | 822 | 35 | 4318 | 1427 |
| ENST00000510411 | HNRNPH1 | chr5 | 179044985 | - | ENST00000341500 | INSR | chr19 | 7184648 | - | 9085 | 823 | 36 | 4283 | 1415 |
| ENST00000510411 | HNRNPH1 | chr5 | 179044985 | - | ENST00000302850 | INSR | chr19 | 7184648 | - | 4749 | 823 | 36 | 4319 | 1427 |
| ENST00000442819 | HNRNPH1 | chr5 | 179044990 | - | ENST00000341500 | INSR | chr19 | 7184648 | - | 9166 | 904 | 117 | 4364 | 1415 |
| ENST00000442819 | HNRNPH1 | chr5 | 179044990 | - | ENST00000302850 | INSR | chr19 | 7184648 | - | 4830 | 904 | 117 | 4400 | 1427 |
| ENST00000356731 | HNRNPH1 | chr5 | 179044990 | - | ENST00000341500 | INSR | chr19 | 7184648 | - | 10585 | 2323 | 1536 | 5783 | 1415 |
| ENST00000356731 | HNRNPH1 | chr5 | 179044990 | - | ENST00000302850 | INSR | chr19 | 7184648 | - | 6249 | 2323 | 1536 | 5819 | 1427 |
| ENST00000329433 | HNRNPH1 | chr5 | 179044990 | - | ENST00000341500 | INSR | chr19 | 7184648 | - | 9084 | 822 | 35 | 4282 | 1415 |
| ENST00000329433 | HNRNPH1 | chr5 | 179044990 | - | ENST00000302850 | INSR | chr19 | 7184648 | - | 4748 | 822 | 35 | 4318 | 1427 |
| ENST00000510411 | HNRNPH1 | chr5 | 179044990 | - | ENST00000341500 | INSR | chr19 | 7184648 | - | 9085 | 823 | 36 | 4283 | 1415 |
| ENST00000510411 | HNRNPH1 | chr5 | 179044990 | - | ENST00000302850 | INSR | chr19 | 7184648 | - | 4749 | 823 | 36 | 4319 | 1427 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000442819 | ENST00000341500 | HNRNPH1 | chr5 | 179044985 | - | INSR | chr19 | 7184648 | - | 0.000165583 | 0.9998344 |
| ENST00000442819 | ENST00000302850 | HNRNPH1 | chr5 | 179044985 | - | INSR | chr19 | 7184648 | - | 0.001388211 | 0.9986118 |
| ENST00000356731 | ENST00000341500 | HNRNPH1 | chr5 | 179044985 | - | INSR | chr19 | 7184648 | - | 0.000915151 | 0.99908483 |
| ENST00000356731 | ENST00000302850 | HNRNPH1 | chr5 | 179044985 | - | INSR | chr19 | 7184648 | - | 0.004660619 | 0.9953394 |
| ENST00000329433 | ENST00000341500 | HNRNPH1 | chr5 | 179044985 | - | INSR | chr19 | 7184648 | - | 0.00014793 | 0.99985206 |
| ENST00000329433 | ENST00000302850 | HNRNPH1 | chr5 | 179044985 | - | INSR | chr19 | 7184648 | - | 0.001243103 | 0.9987569 |
| ENST00000510411 | ENST00000341500 | HNRNPH1 | chr5 | 179044985 | - | INSR | chr19 | 7184648 | - | 0.000148622 | 0.99985135 |
| ENST00000510411 | ENST00000302850 | HNRNPH1 | chr5 | 179044985 | - | INSR | chr19 | 7184648 | - | 0.001253312 | 0.99874663 |
| ENST00000442819 | ENST00000341500 | HNRNPH1 | chr5 | 179044990 | - | INSR | chr19 | 7184648 | - | 0.000165583 | 0.9998344 |
| ENST00000442819 | ENST00000302850 | HNRNPH1 | chr5 | 179044990 | - | INSR | chr19 | 7184648 | - | 0.001388211 | 0.9986118 |
| ENST00000356731 | ENST00000341500 | HNRNPH1 | chr5 | 179044990 | - | INSR | chr19 | 7184648 | - | 0.000915151 | 0.99908483 |
| ENST00000356731 | ENST00000302850 | HNRNPH1 | chr5 | 179044990 | - | INSR | chr19 | 7184648 | - | 0.004660619 | 0.9953394 |
| ENST00000329433 | ENST00000341500 | HNRNPH1 | chr5 | 179044990 | - | INSR | chr19 | 7184648 | - | 0.00014793 | 0.99985206 |
| ENST00000329433 | ENST00000302850 | HNRNPH1 | chr5 | 179044990 | - | INSR | chr19 | 7184648 | - | 0.001243103 | 0.9987569 |
| ENST00000510411 | ENST00000341500 | HNRNPH1 | chr5 | 179044990 | - | INSR | chr19 | 7184648 | - | 0.000148622 | 0.99985135 |
| ENST00000510411 | ENST00000302850 | HNRNPH1 | chr5 | 179044990 | - | INSR | chr19 | 7184648 | - | 0.001253312 | 0.99874663 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for HNRNPH1-INSR |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| HNRNPH1 | chr5 | 179044985 | INSR | chr19 | 7184648 | 2323 | 262 | NDGYGFGSDRFGRVCPTICKSHGCTA |
| HNRNPH1 | chr5 | 179044985 | INSR | chr19 | 7184648 | 822 | 262 | NDGYGFGSDRFGRVCPTICKSHGCTA |
| HNRNPH1 | chr5 | 179044985 | INSR | chr19 | 7184648 | 823 | 262 | NDGYGFGSDRFGRVCPTICKSHGCTA |
| HNRNPH1 | chr5 | 179044985 | INSR | chr19 | 7184648 | 904 | 262 | NDGYGFGSDRFGRVCPTICKSHGCTA |
| HNRNPH1 | chr5 | 179044990 | INSR | chr19 | 7184648 | 2323 | 262 | NDGYGFGSDRFGRVCPTICKSHGCTA |
| HNRNPH1 | chr5 | 179044990 | INSR | chr19 | 7184648 | 822 | 262 | NDGYGFGSDRFGRVCPTICKSHGCTA |
| HNRNPH1 | chr5 | 179044990 | INSR | chr19 | 7184648 | 823 | 262 | NDGYGFGSDRFGRVCPTICKSHGCTA |
| HNRNPH1 | chr5 | 179044990 | INSR | chr19 | 7184648 | 904 | 262 | NDGYGFGSDRFGRVCPTICKSHGCTA |
Top |
Potential FusionNeoAntigen Information of HNRNPH1-INSR in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| HNRNPH1-INSR_179044985_7184648.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| HNRNPH1-INSR | chr5 | 179044985 | chr19 | 7184648 | 822 | HLA-B27:05 | GRVCPTICK | 0.9983 | 0.8397 | 11 | 20 |
| HNRNPH1-INSR | chr5 | 179044985 | chr19 | 7184648 | 822 | HLA-B14:02 | DRFGRVCPTI | 0.9948 | 0.8673 | 8 | 18 |
| HNRNPH1-INSR | chr5 | 179044985 | chr19 | 7184648 | 822 | HLA-B14:01 | DRFGRVCPTI | 0.9948 | 0.8673 | 8 | 18 |
| HNRNPH1-INSR | chr5 | 179044985 | chr19 | 7184648 | 822 | HLA-B27:14 | GRVCPTICK | 0.9974 | 0.734 | 11 | 20 |
| HNRNPH1-INSR | chr5 | 179044985 | chr19 | 7184648 | 822 | HLA-B73:01 | DRFGRVCPT | 0.9947 | 0.9268 | 8 | 17 |
| HNRNPH1-INSR | chr5 | 179044985 | chr19 | 7184648 | 822 | HLA-B27:10 | GRVCPTICK | 0.9976 | 0.7716 | 11 | 20 |
Top |
Potential FusionNeoAntigen Information of HNRNPH1-INSR in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of HNRNPH1-INSR |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 3115 | GSDRFGRVCPTICK | HNRNPH1 | INSR | chr5 | 179044985 | chr19 | 7184648 | 822 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of HNRNPH1-INSR |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 3115 | GSDRFGRVCPTICK | -7.15543 | -7.26883 |
| HLA-B14:02 | 3BVN | 3115 | GSDRFGRVCPTICK | -4.77435 | -5.80965 |
| HLA-B52:01 | 3W39 | 3115 | GSDRFGRVCPTICK | -6.80875 | -6.92215 |
| HLA-B52:01 | 3W39 | 3115 | GSDRFGRVCPTICK | -4.20386 | -5.23916 |
| HLA-A11:01 | 4UQ2 | 3115 | GSDRFGRVCPTICK | -7.5194 | -8.5547 |
| HLA-A11:01 | 4UQ2 | 3115 | GSDRFGRVCPTICK | -6.9601 | -7.0735 |
| HLA-A24:02 | 5HGA | 3115 | GSDRFGRVCPTICK | -7.52403 | -7.63743 |
| HLA-A24:02 | 5HGA | 3115 | GSDRFGRVCPTICK | -5.82433 | -6.85963 |
| HLA-B27:05 | 6PYJ | 3115 | GSDRFGRVCPTICK | -3.28285 | -4.31815 |
| HLA-B44:05 | 3DX8 | 3115 | GSDRFGRVCPTICK | -5.91172 | -6.94702 |
| HLA-B44:05 | 3DX8 | 3115 | GSDRFGRVCPTICK | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of HNRNPH1-INSR |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| HNRNPH1-INSR | chr5 | 179044985 | chr19 | 7184648 | 11 | 20 | GRVCPTICK | GAAGAGTTTGCCCGACCATCTGTAAGT |
| HNRNPH1-INSR | chr5 | 179044985 | chr19 | 7184648 | 8 | 17 | DRFGRVCPT | ATAGATTTGGAAGAGTTTGCCCGACCA |
| HNRNPH1-INSR | chr5 | 179044985 | chr19 | 7184648 | 8 | 18 | DRFGRVCPTI | ATAGATTTGGAAGAGTTTGCCCGACCATCT |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of HNRNPH1-INSR |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| SARC | HNRNPH1-INSR | chr5 | 179044985 | ENST00000329433 | chr19 | 7184648 | ENST00000302850 | TCGA-3B-A9HS-01A |
Top |
Potential target of CAR-T therapy development for HNRNPH1-INSR |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Tgene | INSR | chr5:179044985 | chr19:7184648 | ENST00000302850 | 1 | 22 | 957_979 | 0 | 1383.0 | Transmembrane | Helical | |
| Tgene | INSR | chr5:179044985 | chr19:7184648 | ENST00000341500 | 1 | 21 | 957_979 | 0 | 1371.0 | Transmembrane | Helical | |
| Tgene | INSR | chr5:179044990 | chr19:7184648 | ENST00000302850 | 1 | 22 | 957_979 | 0 | 1383.0 | Transmembrane | Helical | |
| Tgene | INSR | chr5:179044990 | chr19:7184648 | ENST00000341500 | 1 | 21 | 957_979 | 0 | 1371.0 | Transmembrane | Helical |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
| HNRNPH1 | chr5 | 179044985 | ENST00000329433 | INSR | chr19 | 7184648 | ENST00000302850 |  |
| HNRNPH1 | chr5 | 179044985 | ENST00000329433 | INSR | chr19 | 7184648 | ENST00000341500 |  |
Top |
Related Drugs to HNRNPH1-INSR |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to HNRNPH1-INSR |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies