Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:HPSE2-CWF19L1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: HPSE2-CWF19L1
	FusionPDB ID: 37548
	FusionGDB2.0 ID: 37548
		Hgene	Tgene
	Gene symbol	HPSE2	CWF19L1
	Gene ID	60495	55280
	Gene name	heparanase 2 (inactive)	CWF19 like cell cycle control factor 1
	Synonyms	HPA2\|HPR2\|UFS\|UFS1	C19L1\|SCAR17\|hDrn1
	Cytomap	10q24.2	10q24.31
	Type of gene	protein-coding	protein-coding
	Description	inactive heparanase-2heparanase 3heparanase-like protein	CWF19-like protein 1CWF19 like 1, cell cycle controlCWF19-like 1 cell cycle controlhuman Dbr1 associated ribonuclease 1
	Modification date	20200313	20200313
	UniProtAcc	Q8WWQ2 Main function of 5'-partner protein: FUNCTION: Binds heparin and heparan sulfate with high affinity, but lacks heparanase activity. Inhibits HPSE, possibly by competing for its substrates (in vitro). {ECO:0000269\|PubMed:20576607}.	Q69YN2 Main function of 5'-partner protein:
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000370546, ENST00000370549, ENST00000370552, ENST00000404542,	ENST00000370379, ENST00000478047, ENST00000354105,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	7 X 7 X 3=147	4 X 4 X 4=64
	# samples	7	4
	** MAII score	log2(7/147*10)=-1.0703893278914 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(4/64*10)=-0.678071905112638 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: HPSE2 [Title/Abstract] AND CWF19L1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: HPSE2 [Title/Abstract] AND CWF19L1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	HPSE2(100903995)-CWF19L1(102003534), # samples:2
Anticipated loss of major functional domain due to fusion event.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr10:100903995/chr10:102003534)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across HPSE2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across CWF19L1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000370549	HPSE2	chr10	100903995	-	ENST00000354105	CWF19L1	chr10	102003534	-	2252	670	60	1322	420
ENST00000370552	HPSE2	chr10	100903995	-	ENST00000354105	CWF19L1	chr10	102003534	-	2252	670	60	1322	420
ENST00000370546	HPSE2	chr10	100903995	-	ENST00000354105	CWF19L1	chr10	102003534	-	2192	610	0	1262	420

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000370549	ENST00000354105	HPSE2	chr10	100903995	-	CWF19L1	chr10	102003534	-	0.00148244	0.9985176
ENST00000370552	ENST00000354105	HPSE2	chr10	100903995	-	CWF19L1	chr10	102003534	-	0.00148244	0.9985176
ENST00000370546	ENST00000354105	HPSE2	chr10	100903995	-	CWF19L1	chr10	102003534	-	0.001501263	0.9984988

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for HPSE2-CWF19L1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
HPSE2	chr10	100903995	CWF19L1	chr10	102003534	610	203	EQFSNTYSNLILTAQPPGPCWFCLAS
HPSE2	chr10	100903995	CWF19L1	chr10	102003534	670	203	EQFSNTYSNLILTAQPPGPCWFCLAS

Top

Potential FusionNeoAntigen Information of HPSE2-CWF19L1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

HPSE2-CWF19L1_100903995_102003534.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B58:01	TAQPPGPCW	0.9884	0.989	12	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B57:01	TAQPPGPCW	0.9879	0.9892	12	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B58:02	TAQPPGPCW	0.9735	0.9911	12	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B15:17	TAQPPGPCW	0.9549	0.987	12	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B53:01	TAQPPGPCW	0.9387	0.932	12	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B15:16	TAQPPGPCW	0.9291	0.9896	12	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B35:08	TAQPPGPCW	0.8539	0.9195	12	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B57:03	TAQPPGPCW	0.7878	0.9976	12	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-A32:13	TAQPPGPCW	0.4613	0.9914	12	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B57:01	LTAQPPGPCW	0.9994	0.9873	11	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B58:01	LTAQPPGPCW	0.9976	0.9889	11	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B58:02	LTAQPPGPCW	0.9974	0.9908	11	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B15:17	LTAQPPGPCW	0.9954	0.9797	11	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B15:16	LTAQPPGPCW	0.9614	0.986	11	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B57:03	LTAQPPGPCW	0.8871	0.9973	11	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B53:01	LTAQPPGPCW	0.7993	0.9286	11	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B57:01	ILTAQPPGPCW	0.9989	0.9873	10	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B58:02	ILTAQPPGPCW	0.9894	0.988	10	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B58:01	ILTAQPPGPCW	0.9846	0.9793	10	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B57:03	ILTAQPPGPCW	0.9431	0.9964	10	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B44:06	TAQPPGPCW	0.3491	0.6776	12	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B44:08	TAQPPGPCW	0.3346	0.9579	12	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B57:04	TAQPPGPCW	0.9935	0.9173	12	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B57:10	TAQPPGPCW	0.9879	0.9892	12	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B58:06	TAQPPGPCW	0.9738	0.9918	12	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B15:13	TAQPPGPCW	0.9529	0.9833	12	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B53:02	TAQPPGPCW	0.8913	0.917	12	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B57:02	TAQPPGPCW	0.87	0.9867	12	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B15:24	TAQPPGPCW	0.4052	0.9895	12	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B51:06	TAQPPGPCW	0.1971	0.9168	12	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-A25:01	TAQPPGPCW	0.0469	0.9697	12	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B57:10	LTAQPPGPCW	0.9994	0.9873	11	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B57:04	LTAQPPGPCW	0.9992	0.9211	11	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B58:06	LTAQPPGPCW	0.9958	0.99	11	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B57:02	LTAQPPGPCW	0.9825	0.9863	11	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B57:10	ILTAQPPGPCW	0.9989	0.9873	10	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B57:04	ILTAQPPGPCW	0.997	0.9286	10	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B58:06	ILTAQPPGPCW	0.9884	0.9642	10	21
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	HLA-B57:02	ILTAQPPGPCW	0.9787	0.9915	10	21

Top

Potential FusionNeoAntigen Information of HPSE2-CWF19L1 in HLA II

HPSE2-CWF19L1_100903995_102003534.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	DRB1-0701	EQFSNTYSNLILTAQ	0	15
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	DRB1-0703	EQFSNTYSNLILTAQ	0	15
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	DRB1-0705	EQFSNTYSNLILTAQ	0	15
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	DRB1-0707	EQFSNTYSNLILTAQ	0	15
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	DRB1-0708	EQFSNTYSNLILTAQ	0	15
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	DRB1-0709	EQFSNTYSNLILTAQ	0	15
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	DRB1-0712	EQFSNTYSNLILTAQ	0	15
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	DRB1-0713	EQFSNTYSNLILTAQ	0	15
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	DRB1-0714	EQFSNTYSNLILTAQ	0	15
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	DRB1-0715	EQFSNTYSNLILTAQ	0	15
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	DRB1-0716	EQFSNTYSNLILTAQ	0	15
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	DRB1-0717	EQFSNTYSNLILTAQ	0	15
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	610	DRB1-0719	EQFSNTYSNLILTAQ	0	15

Top

Fusion breakpoint peptide structures of HPSE2-CWF19L1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
10812	YSNLILTAQPPGPC	HPSE2	CWF19L1	chr10	100903995	chr10	102003534	610

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of HPSE2-CWF19L1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	10812	YSNLILTAQPPGPC	-7.75776	-7.86956
HLA-B14:02	3BVN	10812	YSNLILTAQPPGPC	-4.52646	-5.56956
HLA-B52:01	3W39	10812	YSNLILTAQPPGPC	-7.1873	-7.2991
HLA-B52:01	3W39	10812	YSNLILTAQPPGPC	-2.81174	-3.85484
HLA-A11:01	4UQ2	10812	YSNLILTAQPPGPC	-5.13576	-5.24756
HLA-A24:02	5HGA	10812	YSNLILTAQPPGPC	-8.42076	-8.53256
HLA-A24:02	5HGA	10812	YSNLILTAQPPGPC	-7.10496	-8.14806
HLA-B27:05	6PYJ	10812	YSNLILTAQPPGPC	-9.28296	-9.39476
HLA-B44:05	3DX8	10812	YSNLILTAQPPGPC	-6.88262	-6.99442
HLA-B44:05	3DX8	10812	YSNLILTAQPPGPC	-5.46822	-6.51132

Top

Vaccine Design for the FusionNeoAntigens of HPSE2-CWF19L1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	10	21	ILTAQPPGPCW	TATTAACAGCTCAGCCTCCAGGACCCTGCTGGT
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	11	21	LTAQPPGPCW	TAACAGCTCAGCCTCCAGGACCCTGCTGGT
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	12	21	TAQPPGPCW	CAGCTCAGCCTCCAGGACCCTGCTGGT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
HPSE2-CWF19L1	chr10	100903995	chr10	102003534	0	15	EQFSNTYSNLILTAQ	AGCAATTCTCCAATACTTACAGTAATCTCATATTAACAGCTCAGC

Top

Information of the samples that have these potential fusion neoantigens of HPSE2-CWF19L1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LGG	HPSE2-CWF19L1	chr10	100903995	ENST00000370546	chr10	102003534	ENST00000354105	TCGA-FN-7833-01A

Top

Potential target of CAR-T therapy development for HPSE2-CWF19L1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to HPSE2-CWF19L1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to HPSE2-CWF19L1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)