|
|||||||
|
Fusion Protein:HSF1-CPSF3L |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: HSF1-CPSF3L | FusionPDB ID: 37706 | FusionGDB2.0 ID: 37706 | Hgene | Tgene | Gene symbol | HSF1 | CPSF3L | Gene ID | 3297 | 54973 |
| Gene name | heat shock transcription factor 1 | integrator complex subunit 11 | |
| Synonyms | HSTF1 | CPSF3L|CPSF73L|INT11|RC-68|RC68 | |
| Cytomap | 8q24.3 | 1p36.33 | |
| Type of gene | protein-coding | protein-coding | |
| Description | heat shock factor protein 1 | integrator complex subunit 11CPSF3-like proteincleavage and polyadenylation specific factor 3-likecleavage and polyadenylation-specific factor 3-like proteinprotein related to CPSF subunits of 68 kDarelated to CPSF subunits 68 kDa | |
| Modification date | 20200322 | 20200313 | |
| UniProtAcc | Q00613 Main function of 5'-partner protein: FUNCTION: Functions as a stress-inducible and DNA-binding transcription factor that plays a central role in the transcriptional activation of the heat shock response (HSR), leading to the expression of a large class of molecular chaperones heat shock proteins (HSPs) that protect cells from cellular insults' damage (PubMed:1871105, PubMed:11447121, PubMed:1986252, PubMed:7760831, PubMed:7623826, PubMed:8946918, PubMed:8940068, PubMed:9341107, PubMed:9121459, PubMed:9727490, PubMed:9499401, PubMed:9535852, PubMed:12659875, PubMed:12917326, PubMed:15016915, PubMed:25963659, PubMed:26754925). In unstressed cells, is present in a HSP90-containing multichaperone complex that maintains it in a non-DNA-binding inactivated monomeric form (PubMed:9727490, PubMed:11583998, PubMed:16278218). Upon exposure to heat and other stress stimuli, undergoes homotrimerization and activates HSP gene transcription through binding to site-specific heat shock elements (HSEs) present in the promoter regions of HSP genes (PubMed:1871105, PubMed:1986252, PubMed:8455624, PubMed:7935471, PubMed:7623826, PubMed:8940068, PubMed:9727490, PubMed:9499401, PubMed:10359787, PubMed:11583998, PubMed:12659875, PubMed:16278218, PubMed:25963659, PubMed:26754925). Activation is reversible, and during the attenuation and recovery phase period of the HSR, returns to its unactivated form (PubMed:11583998, PubMed:16278218). Binds to inverted 5'-NGAAN-3' pentamer DNA sequences (PubMed:1986252, PubMed:26727489). Binds to chromatin at heat shock gene promoters (PubMed:25963659). Plays also several other functions independently of its transcriptional activity. Involved in the repression of Ras-induced transcriptional activation of the c-fos gene in heat-stressed cells (PubMed:9341107). Positively regulates pre-mRNA 3'-end processing and polyadenylation of HSP70 mRNA upon heat-stressed cells in a symplekin (SYMPK)-dependent manner (PubMed:14707147). Plays a role in nuclear export of stress-induced HSP70 mRNA (PubMed:17897941). Plays a role in the regulation of mitotic progression (PubMed:18794143). Plays also a role as a negative regulator of non-homologous end joining (NHEJ) repair activity in a DNA damage-dependent manner (PubMed:26359349). Involved in stress-induced cancer cell proliferation in a IER5-dependent manner (PubMed:26754925). {ECO:0000269|PubMed:10359787, ECO:0000269|PubMed:11447121, ECO:0000269|PubMed:11583998, ECO:0000269|PubMed:12659875, ECO:0000269|PubMed:12917326, ECO:0000269|PubMed:14707147, ECO:0000269|PubMed:15016915, ECO:0000269|PubMed:16278218, ECO:0000269|PubMed:17897941, ECO:0000269|PubMed:1871105, ECO:0000269|PubMed:18794143, ECO:0000269|PubMed:1986252, ECO:0000269|PubMed:25963659, ECO:0000269|PubMed:26359349, ECO:0000269|PubMed:26727489, ECO:0000269|PubMed:26754925, ECO:0000269|PubMed:7623826, ECO:0000269|PubMed:7760831, ECO:0000269|PubMed:7935471, ECO:0000269|PubMed:8455624, ECO:0000269|PubMed:8940068, ECO:0000269|PubMed:8946918, ECO:0000269|PubMed:9121459, ECO:0000269|PubMed:9341107, ECO:0000269|PubMed:9499401, ECO:0000269|PubMed:9535852, ECO:0000269|PubMed:9727490}.; FUNCTION: (Microbial infection) Plays a role in latent human immunodeficiency virus (HIV-1) transcriptional reactivation. Binds to the HIV-1 long terminal repeat promoter (LTR) to reactivate viral transcription by recruiting cellular transcriptional elongation factors, such as CDK9, CCNT1 and EP300. {ECO:0000269|PubMed:27189267}. | . | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000528842, ENST00000400780, ENST00000528838, | ENST00000411962, ENST00000435064, ENST00000419704, ENST00000421495, ENST00000462432, ENST00000540437, ENST00000450926, ENST00000545578, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 10 X 6 X 8=480 | 8 X 8 X 6=384 |
| # samples | 12 | 10 | |
| ** MAII score | log2(12/480*10)=-2 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(10/384*10)=-1.94110631094643 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: HSF1 [Title/Abstract] AND CPSF3L [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: HSF1 [Title/Abstract] AND CPSF3L [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | HSF1(145537302)-CPSF3L(1250998), # samples:1 | ||
| Anticipated loss of major functional domain due to fusion event. | HSF1-CPSF3L seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. HSF1-CPSF3L seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. HSF1-CPSF3L seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. HSF1-CPSF3L seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | HSF1 | GO:0000122 | negative regulation of transcription by RNA polymerase II | 8926278|9341107 |
| Hgene | HSF1 | GO:0000165 | MAPK cascade | 12917326 |
| Hgene | HSF1 | GO:0009299 | mRNA transcription | 21597468 |
| Hgene | HSF1 | GO:0034605 | cellular response to heat | 7935471|9222587|9341107|10359787|10413683|10747973|11514557|11583998|12917326|14707147|16554823|17897941|21085490|26159920 |
| Hgene | HSF1 | GO:0034620 | cellular response to unfolded protein | 15016915 |
| Hgene | HSF1 | GO:0034622 | cellular protein-containing complex assembly | 11583998 |
| Hgene | HSF1 | GO:0045944 | positive regulation of transcription by RNA polymerase II | 9341107|10561509|11514557|12917326|16278218|21085490 |
| Hgene | HSF1 | GO:0061408 | positive regulation of transcription from RNA polymerase II promoter in response to heat stress | 7760831|9499401|10747973|12659875|12665592|15016915|25963659|26754925 |
| Hgene | HSF1 | GO:0071276 | cellular response to cadmium ion | 10359787|11514557|15016915|25963659 |
| Hgene | HSF1 | GO:0071280 | cellular response to copper ion | 15016915 |
| Hgene | HSF1 | GO:0071480 | cellular response to gamma radiation | 26359349 |
| Hgene | HSF1 | GO:0072738 | cellular response to diamide | 15016915 |
| Hgene | HSF1 | GO:1900034 | regulation of cellular response to heat | 11583998 |
| Hgene | HSF1 | GO:1903936 | cellular response to sodium arsenite | 15016915 |
| Tgene | CPSF3L | GO:0016180 | snRNA processing | 16239144 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr8:145537302/chr1:1250998) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across HSF1 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across CPSF3L (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000528838 | HSF1 | chr8 | 145537302 | + | ENST00000435064 | CPSF3L | chr1 | 1250998 | - | 3044 | 1408 | 43 | 2781 | 912 |
| ENST00000528838 | HSF1 | chr8 | 145537302 | + | ENST00000411962 | CPSF3L | chr1 | 1250998 | - | 3040 | 1408 | 43 | 2781 | 912 |
| ENST00000400780 | HSF1 | chr8 | 145537302 | + | ENST00000435064 | CPSF3L | chr1 | 1250998 | - | 2852 | 1216 | 52 | 2589 | 845 |
| ENST00000400780 | HSF1 | chr8 | 145537302 | + | ENST00000411962 | CPSF3L | chr1 | 1250998 | - | 2848 | 1216 | 52 | 2589 | 845 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000528838 | ENST00000435064 | HSF1 | chr8 | 145537302 | + | CPSF3L | chr1 | 1250998 | - | 0.017449873 | 0.9825501 |
| ENST00000528838 | ENST00000411962 | HSF1 | chr8 | 145537302 | + | CPSF3L | chr1 | 1250998 | - | 0.017541101 | 0.98245883 |
| ENST00000400780 | ENST00000435064 | HSF1 | chr8 | 145537302 | + | CPSF3L | chr1 | 1250998 | - | 0.018593827 | 0.9814062 |
| ENST00000400780 | ENST00000411962 | HSF1 | chr8 | 145537302 | + | CPSF3L | chr1 | 1250998 | - | 0.018735742 | 0.98126423 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for HSF1-CPSF3L |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| HSF1 | chr8 | 145537302 | CPSF3L | chr1 | 1250998 | 1216 | 185 | FSLEHVHGSGPYSAPSPAYSSSSLYA |
| HSF1 | chr8 | 145537302 | CPSF3L | chr1 | 1250998 | 1408 | 280 | FSLEHVHGSGPYSAPSPAYSSSSLYA |
Top |
Potential FusionNeoAntigen Information of HSF1-CPSF3L in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| HSF1-CPSF3L_145537302_1250998.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B15:25 | YSAPSPAY | 0.9995 | 0.9314 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B15:02 | YSAPSPAY | 0.9989 | 0.9392 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B35:08 | YSAPSPAY | 0.9931 | 0.8803 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B35:01 | YSAPSPAY | 0.9903 | 0.8652 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B35:05 | YSAPSPAY | 0.9835 | 0.5427 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B07:05 | GPYSAPSPA | 0.9989 | 0.6149 | 9 | 18 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B07:02 | GPYSAPSPA | 0.9989 | 0.6034 | 9 | 18 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B39:01 | VHGSGPYSA | 0.9936 | 0.9328 | 5 | 14 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B39:06 | VHGSGPYSA | 0.9917 | 0.9652 | 5 | 14 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B15:10 | VHGSGPYSA | 0.7224 | 0.5599 | 5 | 14 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B35:01 | GPYSAPSPAY | 0.9841 | 0.9229 | 9 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B35:08 | GPYSAPSPAY | 0.979 | 0.9059 | 9 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B15:02 | GPYSAPSPAY | 0.9609 | 0.9651 | 9 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B35:05 | GPYSAPSPAY | 0.9597 | 0.7117 | 9 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B39:06 | HVHGSGPYSA | 0.6327 | 0.9558 | 4 | 14 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B39:06 | EHVHGSGPYSA | 0.9992 | 0.9725 | 3 | 14 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-A24:17 | SGPYSAPSPAY | 0.4949 | 0.6214 | 8 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B15:21 | YSAPSPAY | 0.9989 | 0.9261 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-C15:04 | YSAPSPAY | 0.9977 | 0.8983 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B15:31 | YSAPSPAY | 0.9911 | 0.8655 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-C03:14 | YSAPSPAY | 0.9747 | 0.9749 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-C12:12 | YSAPSPAY | 0.9609 | 0.903 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-C12:04 | YSAPSPAY | 0.9584 | 0.995 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-C06:03 | YSAPSPAY | 0.957 | 0.9937 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B54:01 | GPYSAPSPA | 0.9943 | 0.5569 | 9 | 18 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B39:09 | VHGSGPYSA | 0.9929 | 0.8983 | 5 | 14 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B07:12 | GPYSAPSPA | 0.9912 | 0.7018 | 9 | 18 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B39:05 | VHGSGPYSA | 0.9879 | 0.9246 | 5 | 14 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B07:04 | GPYSAPSPA | 0.9238 | 0.6245 | 9 | 18 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B56:04 | GPYSAPSPA | 0.9106 | 0.5437 | 9 | 18 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B15:21 | PYSAPSPAY | 0.8291 | 0.9199 | 10 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B78:01 | GPYSAPSPA | 0.7003 | 0.6878 | 9 | 18 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B54:01 | SGPYSAPSPA | 0.9864 | 0.5999 | 8 | 18 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B15:31 | GPYSAPSPAY | 0.9827 | 0.9277 | 9 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B15:21 | GPYSAPSPAY | 0.9573 | 0.9504 | 9 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B15:21 | SGPYSAPSPAY | 0.9845 | 0.9204 | 8 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B15:39 | YSAPSPAY | 0.9994 | 0.8595 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B15:11 | YSAPSPAY | 0.9989 | 0.9016 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B15:08 | YSAPSPAY | 0.9989 | 0.8947 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B35:11 | YSAPSPAY | 0.9987 | 0.9079 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B35:43 | YSAPSPAY | 0.9985 | 0.8989 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-C03:02 | YSAPSPAY | 0.9982 | 0.973 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-C15:09 | YSAPSPAY | 0.9977 | 0.8983 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B35:17 | YSAPSPAY | 0.9951 | 0.7206 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B35:30 | YSAPSPAY | 0.9951 | 0.7206 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B35:28 | YSAPSPAY | 0.9931 | 0.9016 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-C12:02 | YSAPSPAY | 0.9921 | 0.9639 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B35:23 | YSAPSPAY | 0.9909 | 0.8197 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B35:20 | YSAPSPAY | 0.9903 | 0.9096 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B35:77 | YSAPSPAY | 0.9903 | 0.8652 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-C16:04 | YSAPSPAY | 0.9763 | 0.9772 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B35:24 | YSAPSPAY | 0.9634 | 0.9223 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-C12:03 | YSAPSPAY | 0.9505 | 0.979 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-C16:01 | YSAPSPAY | 0.9172 | 0.9768 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-C16:02 | YSAPSPAY | 0.9144 | 0.9935 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-C02:02 | YSAPSPAY | 0.7677 | 0.979 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-C02:10 | YSAPSPAY | 0.7677 | 0.979 | 11 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B07:22 | GPYSAPSPA | 0.9989 | 0.6034 | 9 | 18 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B07:09 | GPYSAPSPA | 0.9986 | 0.6176 | 9 | 18 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B55:04 | GPYSAPSPA | 0.9553 | 0.5341 | 9 | 18 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B56:05 | GPYSAPSPA | 0.9403 | 0.5398 | 9 | 18 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B56:02 | GPYSAPSPA | 0.9106 | 0.5437 | 9 | 18 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B67:01 | GPYSAPSPA | 0.8433 | 0.9426 | 9 | 18 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B15:09 | VHGSGPYSA | 0.7938 | 0.8628 | 5 | 14 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B07:26 | GPYSAPSPA | 0.6758 | 0.6157 | 9 | 18 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B39:11 | VHGSGPYSA | 0.5631 | 0.903 | 5 | 14 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B78:02 | GPYSAPSPA | 0.5478 | 0.838 | 9 | 18 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-C14:03 | PYSAPSPAY | 0.011 | 0.9695 | 10 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-C14:02 | PYSAPSPAY | 0.011 | 0.9695 | 10 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B07:09 | GPYSAPSPAY | 0.9841 | 0.5661 | 9 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B35:77 | GPYSAPSPAY | 0.9841 | 0.9229 | 9 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B35:23 | GPYSAPSPAY | 0.9833 | 0.9203 | 9 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B35:20 | GPYSAPSPAY | 0.9788 | 0.954 | 9 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B35:30 | GPYSAPSPAY | 0.9721 | 0.8538 | 9 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B35:17 | GPYSAPSPAY | 0.9721 | 0.8538 | 9 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B35:11 | GPYSAPSPAY | 0.9645 | 0.9419 | 9 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B15:08 | GPYSAPSPAY | 0.9351 | 0.9147 | 9 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B15:11 | GPYSAPSPAY | 0.9331 | 0.9189 | 9 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B35:24 | GPYSAPSPAY | 0.923 | 0.908 | 9 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B35:43 | GPYSAPSPAY | 0.9153 | 0.9149 | 9 | 19 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B78:02 | SGPYSAPSPA | 0.782 | 0.8337 | 8 | 18 |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 | HLA-B18:07 | GPYSAPSPAY | 0.266 | 0.9165 | 9 | 19 |
Top |
Potential FusionNeoAntigen Information of HSF1-CPSF3L in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of HSF1-CPSF3L |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 3339 | HGSGPYSAPSPAYS | HSF1 | CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 1216 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of HSF1-CPSF3L |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B52:01 | 3W39 | 3339 | HGSGPYSAPSPAYS | -5.36671 | -5.36671 |
| HLA-B44:05 | 3DX8 | 3339 | HGSGPYSAPSPAYS | -6.86648 | -6.86648 |
Top |
Vaccine Design for the FusionNeoAntigens of HSF1-CPSF3L |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 10 | 19 | PYSAPSPAY | CTGCTGGACGTAGATGATGAGCTGGAG |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 11 | 19 | YSAPSPAY | CTGGACGTAGATGATGAGCTGGAG |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 3 | 14 | EHVHGSGPYSA | TTCAGCGTGGACACCAGTGCCCTGCTGGACGTA |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 4 | 14 | HVHGSGPYSA | AGCGTGGACACCAGTGCCCTGCTGGACGTA |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 5 | 14 | VHGSGPYSA | GTGGACACCAGTGCCCTGCTGGACGTA |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 8 | 18 | SGPYSAPSPA | AGTGCCCTGCTGGACGTAGATGATGAGCTG |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 8 | 19 | SGPYSAPSPAY | AGTGCCCTGCTGGACGTAGATGATGAGCTGGAG |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 9 | 18 | GPYSAPSPA | GCCCTGCTGGACGTAGATGATGAGCTG |
| HSF1-CPSF3L | chr8 | 145537302 | chr1 | 1250998 | 9 | 19 | GPYSAPSPAY | GCCCTGCTGGACGTAGATGATGAGCTGGAG |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of HSF1-CPSF3L |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| Non-Cancer | HSF1-CPSF3L | chr8 | 145537302 | ENST00000400780 | chr1 | 1250998 | ENST00000411962 | 67N |
Top |
Potential target of CAR-T therapy development for HSF1-CPSF3L |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to HSF1-CPSF3L |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to HSF1-CPSF3L |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies