|
|||||||
|
Fusion Protein:HSPB1-EGR1 |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: HSPB1-EGR1 | FusionPDB ID: 37933 | FusionGDB2.0 ID: 37933 | Hgene | Tgene | Gene symbol | HSPB1 | EGR1 | Gene ID | 3315 | 1958 |
| Gene name | heat shock protein family B (small) member 1 | early growth response 1 | |
| Synonyms | CMT2F|HEL-S-102|HMN2B|HS.76067|HSP27|HSP28|Hsp25|SRP27 | AT225|G0S30|KROX-24|NGFI-A|TIS8|ZIF-268|ZNF225 | |
| Cytomap | 7q11.23 | 5q31.2 | |
| Type of gene | protein-coding | protein-coding | |
| Description | heat shock protein beta-128 kDa heat shock proteinepididymis secretory protein Li 102estrogen-regulated 24 kDa proteinheat shock 27 kDa proteinheat shock 27kD protein 1heat shock 27kDa protein 1stress-responsive protein 27 | early growth response protein 1EGR-1nerve growth factor-induced protein Atranscription factor ETR103transcription factor Zif268zinc finger protein 225zinc finger protein Krox-24 | |
| Modification date | 20200327 | 20200313 | |
| UniProtAcc | Q9Y547 Main function of 5'-partner protein: FUNCTION: Component of the IFT complex B required for sonic hedgehog/SHH signaling. May mediate transport of SHH components: required for the export of SMO and PTCH1 receptors out of the cilium and the accumulation of GLI2 at the ciliary tip in response to activation of the SHH pathway, suggesting it is involved in the dynamic transport of SHH signaling molecules within the cilium. Not required for ciliary assembly. Its role in intraflagellar transport is mainly seen in tissues rich in ciliated cells such as kidney and testis. Essential for male fertility, spermiogenesis and sperm flagella formation. Plays a role in the early development of the kidney. May be involved in the regulation of ureteric bud initiation (By similarity). {ECO:0000250|UniProtKB:Q9D6H2}. | P18146 Main function of 5'-partner protein: FUNCTION: Transcriptional regulator (PubMed:20121949). Recognizes and binds to the DNA sequence 5'-GCG(T/G)GGGCG-3'(EGR-site) in the promoter region of target genes (By similarity). Binds double-stranded target DNA, irrespective of the cytosine methylation status (PubMed:25258363, PubMed:25999311). Regulates the transcription of numerous target genes, and thereby plays an important role in regulating the response to growth factors, DNA damage, and ischemia. Plays a role in the regulation of cell survival, proliferation and cell death. Activates expression of p53/TP53 and TGFB1, and thereby helps prevent tumor formation. Required for normal progress through mitosis and normal proliferation of hepatocytes after partial hepatectomy. Mediates responses to ischemia and hypoxia; regulates the expression of proteins such as IL1B and CXCL2 that are involved in inflammatory processes and development of tissue damage after ischemia. Regulates biosynthesis of luteinizing hormone (LHB) in the pituitary (By similarity). Regulates the amplitude of the expression rhythms of clock genes: ARNTL/BMAL1, PER2 and NR1D1 in the liver via the activation of PER1 (clock repressor) transcription. Regulates the rhythmic expression of core-clock gene ARNTL/BMAL1 in the suprachiasmatic nucleus (SCN) (By similarity). {ECO:0000250|UniProtKB:P08046, ECO:0000269|PubMed:20121949, ECO:0000269|PubMed:25258363, ECO:0000269|PubMed:25999311}. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000248553, ENST00000429938, | ENST00000239938, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 24 X 17 X 8=3264 | 7 X 10 X 3=210 |
| # samples | 26 | 11 | |
| ** MAII score | log2(26/3264*10)=-3.65005752894304 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(11/210*10)=-0.932885804141463 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: HSPB1 [Title/Abstract] AND EGR1 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: HSPB1 [Title/Abstract] AND EGR1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | HSPB1(75933420)-EGR1(137802972), # samples:1 HSPB1(75933533)-EGR1(137802528), # samples:1 | ||
| Anticipated loss of major functional domain due to fusion event. | HSPB1-EGR1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. HSPB1-EGR1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. HSPB1-EGR1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. HSPB1-EGR1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Tgene | EGR1 | GO:0006366 | transcription by RNA polymerase II | 19057511 |
| Tgene | EGR1 | GO:0033233 | regulation of protein sumoylation | 19057511 |
| Tgene | EGR1 | GO:0045893 | positive regulation of transcription, DNA-templated | 12560508 |
| Tgene | EGR1 | GO:0045944 | positive regulation of transcription by RNA polymerase II | 19057511 |
| Tgene | EGR1 | GO:0098759 | cellular response to interleukin-8 | 20363028 |
| Tgene | EGR1 | GO:1902895 | positive regulation of pri-miRNA transcription by RNA polymerase II | 19307576 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr7:75933420/chr5:137802972) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across HSPB1 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across EGR1 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000248553 | HSPB1 | chr7 | 75933420 | + | ENST00000239938 | EGR1 | chr5 | 137802972 | + | 2821 | 789 | 690 | 1586 | 298 |
| ENST00000429938 | HSPB1 | chr7 | 75933420 | + | ENST00000239938 | EGR1 | chr5 | 137802972 | + | 2439 | 407 | 308 | 1204 | 298 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000248553 | ENST00000239938 | HSPB1 | chr7 | 75933420 | + | EGR1 | chr5 | 137802972 | + | 0.51534647 | 0.48465356 |
| ENST00000429938 | ENST00000239938 | HSPB1 | chr7 | 75933420 | + | EGR1 | chr5 | 137802972 | + | 0.35648906 | 0.64351094 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for HSPB1-EGR1 |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| HSPB1 | chr7 | 75933420 | EGR1 | chr5 | 137802972 | 407 | 33 | FCFSQIKFKATTCSRTQQPSLTPLST |
| HSPB1 | chr7 | 75933420 | EGR1 | chr5 | 137802972 | 789 | 33 | FCFSQIKFKATTCSRTQQPSLTPLST |
Top |
Potential FusionNeoAntigen Information of HSPB1-EGR1 in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| HSPB1-EGR1_75933420_137802972.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| HSPB1-EGR1 | chr7 | 75933420 | chr5 | 137802972 | 789 | HLA-A31:02 | KFKATTCSR | 0.8163 | 0.5883 | 6 | 15 |
| HSPB1-EGR1 | chr7 | 75933420 | chr5 | 137802972 | 789 | HLA-A31:01 | KFKATTCSR | 0.9868 | 0.5617 | 6 | 15 |
| HSPB1-EGR1 | chr7 | 75933420 | chr5 | 137802972 | 789 | HLA-A30:01 | KFKATTCSR | 0.9835 | 0.8847 | 6 | 15 |
Top |
Potential FusionNeoAntigen Information of HSPB1-EGR1 in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of HSPB1-EGR1 |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 4228 | KFKATTCSRTQQPS | HSPB1 | EGR1 | chr7 | 75933420 | chr5 | 137802972 | 789 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of HSPB1-EGR1 |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 4228 | KFKATTCSRTQQPS | -7.17232 | -7.28572 |
| HLA-B14:02 | 3BVN | 4228 | KFKATTCSRTQQPS | -4.95948 | -5.99478 |
| HLA-B52:01 | 3W39 | 4228 | KFKATTCSRTQQPS | -6.80683 | -6.92023 |
| HLA-B52:01 | 3W39 | 4228 | KFKATTCSRTQQPS | -3.90062 | -4.93592 |
| HLA-A11:01 | 4UQ2 | 4228 | KFKATTCSRTQQPS | 10001 | 10000 |
| HLA-A24:02 | 5HGA | 4228 | KFKATTCSRTQQPS | -8.77961 | -8.89301 |
| HLA-A24:02 | 5HGA | 4228 | KFKATTCSRTQQPS | -5.66496 | -6.70026 |
| HLA-B44:05 | 3DX8 | 4228 | KFKATTCSRTQQPS | -5.65551 | -5.76891 |
| HLA-B44:05 | 3DX8 | 4228 | KFKATTCSRTQQPS | -3.88952 | -4.92482 |
| HLA-A02:01 | 6TDR | 4228 | KFKATTCSRTQQPS | -4.65662 | -5.69192 |
Top |
Vaccine Design for the FusionNeoAntigens of HSPB1-EGR1 |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| HSPB1-EGR1 | chr7 | 75933420 | chr5 | 137802972 | 6 | 15 | KFKATTCSR | AAGTTCAAAGCAACCACCTGTAGCCGC |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of HSPB1-EGR1 |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| BRCA | HSPB1-EGR1 | chr7 | 75933420 | ENST00000248553 | chr5 | 137802972 | ENST00000239938 | TCGA-GI-A2C9-11A |
Top |
Potential target of CAR-T therapy development for HSPB1-EGR1 |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to HSPB1-EGR1 |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to HSPB1-EGR1 |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies