![]() |
|||||||
|
Fusion Protein:HUWE1-WNK1 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: HUWE1-WNK1 | FusionPDB ID: 38120 | FusionGDB2.0 ID: 38120 | Hgene | Tgene | Gene symbol | HUWE1 | WNK1 | Gene ID | 10075 | 65125 |
Gene name | HECT, UBA and WWE domain containing E3 ubiquitin protein ligase 1 | WNK lysine deficient protein kinase 1 | |
Synonyms | ARF-BP1|HECTH9|HSPC272|Ib772|LASU1|MRXST|MULE|URE-B1|UREB1 | HSAN2|HSN2|KDP|PPP1R167|PRKWNK1|PSK|p65 | |
Cytomap | Xp11.22 | 12p13.33 | |
Type of gene | protein-coding | protein-coding | |
Description | E3 ubiquitin-protein ligase HUWE1ARF-binding protein 1BJ-HCC-24 tumor antigenHECT domain protein LASU1HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligaseHECT-type E3 ubiquitin transferase HUWE1Mcl-1 ubiquitin ligase E3URE-binding pro | serine/threonine-protein kinase WNK1WNK lysine deficient protein kinase 1 isoformerythrocyte 65 kDa proteinprostate-derived sterile 20-like kinaseprotein kinase with no lysine 1protein phosphatase 1, regulatory subunit 167serine/threonine-protein ki | |
Modification date | 20200313 | 20200327 | |
UniProtAcc | Q7Z6Z7 Main function of 5'-partner protein: FUNCTION: E3 ubiquitin-protein ligase which mediates ubiquitination and subsequent proteasomal degradation of target proteins (PubMed:15989957, PubMed:19713937, PubMed:15567145, PubMed:15767685, PubMed:18488021, PubMed:17567951, PubMed:19037095, PubMed:20534529). Regulates apoptosis by catalyzing the polyubiquitination and degradation of MCL1 (PubMed:15989957). Mediates monoubiquitination of DNA polymerase beta (POLB) at 'Lys-41', 'Lys-61' and 'Lys-81', thereby playing a role in base-excision repair (PubMed:19713937). Also ubiquitinates the p53/TP53 tumor suppressor and core histones including H1, H2A, H2B, H3 and H4 (PubMed:15567145, PubMed:15767685, PubMed:15989956). Ubiquitinates MFN2 to negatively regulate mitochondrial fusion in response to decreased stearoylation of TFRC (PubMed:26214738). Binds to an upstream initiator-like sequence in the preprodynorphin gene. Regulates neural differentiation and proliferation by catalyzing the polyubiquitination and degradation of MYCN (PubMed:18488021). May regulate abundance of CDC6 after DNA damage by polyubiquitinating and targeting CDC6 to degradation (PubMed:17567951). Mediates polyubiquitination of isoform 2 of PA2G4 (PubMed:19037095). Acts in concert with MYCBP2 to regulate the circadian clock gene expression by promoting the lithium-induced ubiquination and degradation of NR1D1 (PubMed:20534529). {ECO:0000269|PubMed:15567145, ECO:0000269|PubMed:15767685, ECO:0000269|PubMed:15989956, ECO:0000269|PubMed:15989957, ECO:0000269|PubMed:17567951, ECO:0000269|PubMed:18488021, ECO:0000269|PubMed:19037095, ECO:0000269|PubMed:19713937, ECO:0000269|PubMed:20534529, ECO:0000269|PubMed:26214738}. | . | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000218328, ENST00000262854, ENST00000342160, ENST00000474288, | ENST00000340908, ENST00000447667, ENST00000530271, ENST00000540360, ENST00000574564, ENST00000315939, ENST00000535572, ENST00000537687, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 17 X 22 X 7=2618 | 13 X 15 X 6=1170 |
# samples | 22 | 14 | |
** MAII score | log2(22/2618*10)=-3.57288966842058 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(14/1170*10)=-3.0630097975258 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: HUWE1 [Title/Abstract] AND WNK1 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: HUWE1 [Title/Abstract] AND WNK1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | HUWE1(53619357)-WNK1(992560), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | HUWE1-WNK1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. HUWE1-WNK1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. HUWE1-WNK1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. HUWE1-WNK1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. HUWE1-WNK1 seems lost the major protein functional domain in Hgene partner, which is a epigenetic factor due to the frame-shifted ORF. HUWE1-WNK1 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. HUWE1-WNK1 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. HUWE1-WNK1 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. HUWE1-WNK1 seems lost the major protein functional domain in Tgene partner, which is a kinase due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | HUWE1 | GO:0000209 | protein polyubiquitination | 15989957 |
Hgene | HUWE1 | GO:0006513 | protein monoubiquitination | 19713937 |
Hgene | HUWE1 | GO:0016574 | histone ubiquitination | 15767685 |
Hgene | HUWE1 | GO:0031398 | positive regulation of protein ubiquitination | 20534529 |
Hgene | HUWE1 | GO:0098779 | positive regulation of mitophagy in response to mitochondrial depolarization | 30217973 |
Tgene | WNK1 | GO:0006468 | protein phosphorylation | 10660600 |
Tgene | WNK1 | GO:0010923 | negative regulation of phosphatase activity | 19389623 |
Tgene | WNK1 | GO:0023016 | signal transduction by trans-phosphorylation | 16669787 |
Tgene | WNK1 | GO:0035556 | intracellular signal transduction | 10660600 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chrX:53619357/chr12:992560) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000262854 | HUWE1 | chrX | 53619357 | - | ENST00000535572 | WNK1 | chr12 | 992560 | + | 10539 | 4374 | 387 | 8030 | 2547 |
ENST00000262854 | HUWE1 | chrX | 53619357 | - | ENST00000537687 | WNK1 | chr12 | 992560 | + | 10694 | 4374 | 387 | 8033 | 2548 |
ENST00000262854 | HUWE1 | chrX | 53619357 | - | ENST00000315939 | WNK1 | chr12 | 992560 | + | 10694 | 4374 | 387 | 8033 | 2548 |
ENST00000218328 | HUWE1 | chrX | 53619357 | - | ENST00000535572 | WNK1 | chr12 | 992560 | + | 10539 | 4374 | 387 | 8030 | 2547 |
ENST00000218328 | HUWE1 | chrX | 53619357 | - | ENST00000537687 | WNK1 | chr12 | 992560 | + | 10694 | 4374 | 387 | 8033 | 2548 |
ENST00000218328 | HUWE1 | chrX | 53619357 | - | ENST00000315939 | WNK1 | chr12 | 992560 | + | 10694 | 4374 | 387 | 8033 | 2548 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000262854 | ENST00000535572 | HUWE1 | chrX | 53619357 | - | WNK1 | chr12 | 992560 | + | 0.002288597 | 0.9977114 |
ENST00000262854 | ENST00000537687 | HUWE1 | chrX | 53619357 | - | WNK1 | chr12 | 992560 | + | 0.002167526 | 0.9978325 |
ENST00000262854 | ENST00000315939 | HUWE1 | chrX | 53619357 | - | WNK1 | chr12 | 992560 | + | 0.002167526 | 0.9978325 |
ENST00000218328 | ENST00000535572 | HUWE1 | chrX | 53619357 | - | WNK1 | chr12 | 992560 | + | 0.002288597 | 0.9977114 |
ENST00000218328 | ENST00000537687 | HUWE1 | chrX | 53619357 | - | WNK1 | chr12 | 992560 | + | 0.002167526 | 0.9978325 |
ENST00000218328 | ENST00000315939 | HUWE1 | chrX | 53619357 | - | WNK1 | chr12 | 992560 | + | 0.002167526 | 0.9978325 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for HUWE1-WNK1 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
HUWE1 | chrX | 53619357 | WNK1 | chr12 | 992560 | 4374 | 1326 | GGSRREPQVNQQQLQQVNNDFILAIE |
Top |
Potential FusionNeoAntigen Information of HUWE1-WNK1 in HLA I |
![]() |
HUWE1-WNK1_53619357_992560.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-B35:02 | EPQVNQQQL | 0.4964 | 0.717 | 5 | 14 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-B35:04 | EPQVNQQQL | 0.4964 | 0.717 | 5 | 14 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-B07:02 | REPQVNQQQL | 0.5013 | 0.5323 | 4 | 14 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-B39:13 | REPQVNQQQL | 0.4145 | 0.9284 | 4 | 14 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-B07:02 | RREPQVNQQQL | 0.9418 | 0.585 | 3 | 14 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-B14:03 | EPQVNQQQL | 0.7539 | 0.7963 | 5 | 14 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-B35:12 | EPQVNQQQL | 0.4964 | 0.717 | 5 | 14 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-B42:02 | EPQVNQQQL | 0.288 | 0.5185 | 5 | 14 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-B39:10 | EPQVNQQQL | 0.2441 | 0.8148 | 5 | 14 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-B42:01 | EPQVNQQQL | 0.1952 | 0.5086 | 5 | 14 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-B39:08 | REPQVNQQQL | 0.7661 | 0.8279 | 4 | 14 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-B07:04 | REPQVNQQQL | 0.748 | 0.5069 | 4 | 14 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-B07:12 | REPQVNQQQL | 0.7182 | 0.6039 | 4 | 14 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-B42:02 | REPQVNQQQL | 0.4791 | 0.5791 | 4 | 14 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-B42:01 | REPQVNQQQL | 0.4234 | 0.5675 | 4 | 14 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-B44:10 | REPQVNQQQL | 0.2223 | 0.5309 | 4 | 14 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-C07:95 | RREPQVNQQQL | 0.9945 | 0.5512 | 3 | 14 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-B07:12 | RREPQVNQQQL | 0.9757 | 0.6716 | 3 | 14 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-B35:09 | EPQVNQQQL | 0.4964 | 0.717 | 5 | 14 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-B67:01 | EPQVNQQQL | 0.2851 | 0.7098 | 5 | 14 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-B08:12 | EPQVNQQQL | 0.1169 | 0.6156 | 5 | 14 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-B15:24 | QQLQQVNNDF | 0.9943 | 0.6685 | 11 | 21 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-B40:04 | REPQVNQQQL | 0.7886 | 0.6828 | 4 | 14 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-B07:22 | REPQVNQQQL | 0.5013 | 0.5323 | 4 | 14 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-B41:03 | REPQVNQQQL | 0.4068 | 0.6674 | 4 | 14 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-C07:01 | RREPQVNQQQL | 0.9953 | 0.5424 | 3 | 14 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-C07:22 | RREPQVNQQQL | 0.9747 | 0.6414 | 3 | 14 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | HLA-B07:22 | RREPQVNQQQL | 0.9418 | 0.585 | 3 | 14 |
Top |
Potential FusionNeoAntigen Information of HUWE1-WNK1 in HLA II |
![]() |
HUWE1-WNK1_53619357_992560.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | DRB4-0101 | EPQVNQQQLQQVNND | 5 | 20 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | DRB4-0101 | REPQVNQQQLQQVNN | 4 | 19 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | DRB4-0103 | EPQVNQQQLQQVNND | 5 | 20 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | DRB4-0103 | REPQVNQQQLQQVNN | 4 | 19 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | DRB4-0104 | EPQVNQQQLQQVNND | 5 | 20 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | DRB4-0104 | REPQVNQQQLQQVNN | 4 | 19 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | DRB4-0106 | EPQVNQQQLQQVNND | 5 | 20 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | DRB4-0106 | REPQVNQQQLQQVNN | 4 | 19 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | DRB4-0107 | EPQVNQQQLQQVNND | 5 | 20 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | DRB4-0107 | REPQVNQQQLQQVNN | 4 | 19 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | DRB4-0108 | EPQVNQQQLQQVNND | 5 | 20 |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 | DRB4-0108 | REPQVNQQQLQQVNN | 4 | 19 |
Top |
Fusion breakpoint peptide structures of HUWE1-WNK1 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
6930 | PQVNQQQLQQVNND | HUWE1 | WNK1 | chrX | 53619357 | chr12 | 992560 | 4374 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of HUWE1-WNK1 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 6930 | PQVNQQQLQQVNND | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 6930 | PQVNQQQLQQVNND | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 6930 | PQVNQQQLQQVNND | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 6930 | PQVNQQQLQQVNND | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 6930 | PQVNQQQLQQVNND | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 6930 | PQVNQQQLQQVNND | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 6930 | PQVNQQQLQQVNND | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 6930 | PQVNQQQLQQVNND | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 6930 | PQVNQQQLQQVNND | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 6930 | PQVNQQQLQQVNND | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 6930 | PQVNQQQLQQVNND | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of HUWE1-WNK1 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 11 | 21 | QQLQQVNNDF | CAACAGGTGAACAATGACTTTATTCTAGCA |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 3 | 14 | RREPQVNQQQL | CCTCAAGTCAACCAGCAACAACTGCAACAGGTG |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4 | 14 | REPQVNQQQL | CAAGTCAACCAGCAACAACTGCAACAGGTG |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 5 | 14 | EPQVNQQQL | GTCAACCAGCAACAACTGCAACAGGTG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 4 | 19 | REPQVNQQQLQQVNN | CAAGTCAACCAGCAACAACTGCAACAGGTGAACAATGACTTTATT |
HUWE1-WNK1 | chrX | 53619357 | chr12 | 992560 | 5 | 20 | EPQVNQQQLQQVNND | GTCAACCAGCAACAACTGCAACAGGTGAACAATGACTTTATTCTA |
Top |
Information of the samples that have these potential fusion neoantigens of HUWE1-WNK1 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
STAD | HUWE1-WNK1 | chrX | 53619357 | ENST00000218328 | chr12 | 992560 | ENST00000315939 | TCGA-B7-A5TN |
Top |
Potential target of CAR-T therapy development for HUWE1-WNK1 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to HUWE1-WNK1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to HUWE1-WNK1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |