![]() |
|||||||
|
Fusion Protein:IFT81-ACACB |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: IFT81-ACACB | FusionPDB ID: 38449 | FusionGDB2.0 ID: 38449 | Hgene | Tgene | Gene symbol | IFT81 | ACACB | Gene ID | 28981 | 32 |
Gene name | intraflagellar transport 81 | acetyl-CoA carboxylase beta | |
Synonyms | CDV-1|CDV-1R|CDV1|CDV1R|DV1|SRTD19 | ACC2|ACCB|HACC275 | |
Cytomap | 12q24.11 | 12q24.11 | |
Type of gene | protein-coding | protein-coding | |
Description | intraflagellar transport protein 81 homologcarnitine deficiency-associated gene expressed in ventricle 1carnitine deficiency-associated protein expressed in ventricle 1 | acetyl-CoA carboxylase 2ACC-betaacetyl-Coenzyme A carboxylase beta | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | Q8WYA0 Main function of 5'-partner protein: FUNCTION: Component of the intraflagellar transport (IFT) complex B: together with IFT74, forms a tubulin-binding module that specifically mediates transport of tubulin within the cilium. Binds tubulin via its CH (calponin-homology)-like region (PubMed:23990561). Required for ciliogenesis (PubMed:27666822, PubMed:23990561). Required for proper regulation of SHH signaling (PubMed:27666822). {ECO:0000269|PubMed:23990561, ECO:0000269|PubMed:27666822}. | O00763 Main function of 5'-partner protein: FUNCTION: Mitochondrial enzyme that catalyzes the carboxylation of acetyl-CoA to malonyl-CoA and plays a central role in fatty acid metabolism (PubMed:16854592, PubMed:19236960, PubMed:20457939, PubMed:20952656, PubMed:19900410, PubMed:26976583). Catalyzes a 2 steps reaction starting with the ATP-dependent carboxylation of the biotin carried by the biotin carboxyl carrier (BCC) domain followed by the transfer of the carboxyl group from carboxylated biotin to acetyl-CoA (PubMed:19236960, PubMed:20457939, PubMed:20952656, PubMed:26976583). Through the production of malonyl-CoA that allosterically inhibits carnitine palmitoyltransferase 1 at the mitochondria, negatively regulates fatty acid oxidation (By similarity). Together with its cytosolic isozyme ACACA, which is involved in de novo fatty acid biosynthesis, promotes lipid storage (By similarity). {ECO:0000250|UniProtKB:E9Q4Z2, ECO:0000269|PubMed:16854592, ECO:0000269|PubMed:19236960, ECO:0000269|PubMed:19900410, ECO:0000269|PubMed:20457939, ECO:0000269|PubMed:20952656, ECO:0000269|PubMed:26976583}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000242591, ENST00000552912, ENST00000361948, ENST00000549009, | ENST00000543080, ENST00000543201, ENST00000338432, ENST00000377848, ENST00000377854, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 6 X 6 X 5=180 | 8 X 10 X 3=240 |
# samples | 6 | 9 | |
** MAII score | log2(6/180*10)=-1.58496250072116 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(9/240*10)=-1.41503749927884 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: IFT81 [Title/Abstract] AND ACACB [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: IFT81 [Title/Abstract] AND ACACB [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | IFT81(110647021)-ACACB(109625804), # samples:2 | ||
Anticipated loss of major functional domain due to fusion event. | IFT81-ACACB seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. IFT81-ACACB seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. IFT81-ACACB seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. IFT81-ACACB seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Tgene | ACACB | GO:0006084 | acetyl-CoA metabolic process | 20952656 |
Tgene | ACACB | GO:0051289 | protein homotetramerization | 20952656 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr12:110647021/chr12:109625804) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000552912 | IFT81 | chr12 | 110647021 | + | ENST00000338432 | ACACB | chr12 | 109625804 | + | 9239 | 1978 | 130 | 7374 | 2414 |
ENST00000552912 | IFT81 | chr12 | 110647021 | + | ENST00000377854 | ACACB | chr12 | 109625804 | + | 9026 | 1978 | 130 | 7164 | 2344 |
ENST00000552912 | IFT81 | chr12 | 110647021 | + | ENST00000377848 | ACACB | chr12 | 109625804 | + | 9236 | 1978 | 130 | 7374 | 2414 |
ENST00000242591 | IFT81 | chr12 | 110647021 | + | ENST00000338432 | ACACB | chr12 | 109625804 | + | 9615 | 2354 | 506 | 7750 | 2414 |
ENST00000242591 | IFT81 | chr12 | 110647021 | + | ENST00000377854 | ACACB | chr12 | 109625804 | + | 9402 | 2354 | 506 | 7540 | 2344 |
ENST00000242591 | IFT81 | chr12 | 110647021 | + | ENST00000377848 | ACACB | chr12 | 109625804 | + | 9612 | 2354 | 506 | 7750 | 2414 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000552912 | ENST00000338432 | IFT81 | chr12 | 110647021 | + | ACACB | chr12 | 109625804 | + | 0.000706596 | 0.9992933 |
ENST00000552912 | ENST00000377854 | IFT81 | chr12 | 110647021 | + | ACACB | chr12 | 109625804 | + | 0.000730584 | 0.9992694 |
ENST00000552912 | ENST00000377848 | IFT81 | chr12 | 110647021 | + | ACACB | chr12 | 109625804 | + | 0.000708679 | 0.9992913 |
ENST00000242591 | ENST00000338432 | IFT81 | chr12 | 110647021 | + | ACACB | chr12 | 109625804 | + | 0.00095348 | 0.9990465 |
ENST00000242591 | ENST00000377854 | IFT81 | chr12 | 110647021 | + | ACACB | chr12 | 109625804 | + | 0.000982859 | 0.9990171 |
ENST00000242591 | ENST00000377848 | IFT81 | chr12 | 110647021 | + | ACACB | chr12 | 109625804 | + | 0.000956066 | 0.9990439 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for IFT81-ACACB |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
IFT81 | chr12 | 110647021 | ACACB | chr12 | 109625804 | 1978 | 616 | YTKNTAEQENLGKGFKPSSGTVQELN |
IFT81 | chr12 | 110647021 | ACACB | chr12 | 109625804 | 2354 | 616 | YTKNTAEQENLGKGFKPSSGTVQELN |
Top |
Potential FusionNeoAntigen Information of IFT81-ACACB in HLA I |
![]() |
IFT81-ACACB_110647021_109625804.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
IFT81-ACACB | chr12 | 110647021 | chr12 | 109625804 | 2354 | HLA-B44:03 | QENLGKGF | 0.9991 | 0.9363 | 7 | 15 |
IFT81-ACACB | chr12 | 110647021 | chr12 | 109625804 | 2354 | HLA-B18:01 | QENLGKGF | 0.9972 | 0.5878 | 7 | 15 |
IFT81-ACACB | chr12 | 110647021 | chr12 | 109625804 | 2354 | HLA-B44:03 | AEQENLGKGF | 0.9992 | 0.9534 | 5 | 15 |
IFT81-ACACB | chr12 | 110647021 | chr12 | 109625804 | 2354 | HLA-B45:01 | QENLGKGFKP | 0.9919 | 0.9785 | 7 | 17 |
IFT81-ACACB | chr12 | 110647021 | chr12 | 109625804 | 2354 | HLA-B44:07 | QENLGKGF | 0.9991 | 0.9363 | 7 | 15 |
IFT81-ACACB | chr12 | 110647021 | chr12 | 109625804 | 2354 | HLA-B44:26 | QENLGKGF | 0.9991 | 0.9363 | 7 | 15 |
IFT81-ACACB | chr12 | 110647021 | chr12 | 109625804 | 2354 | HLA-B44:13 | QENLGKGF | 0.9991 | 0.9363 | 7 | 15 |
IFT81-ACACB | chr12 | 110647021 | chr12 | 109625804 | 2354 | HLA-B18:05 | QENLGKGF | 0.9972 | 0.5878 | 7 | 15 |
IFT81-ACACB | chr12 | 110647021 | chr12 | 109625804 | 2354 | HLA-B18:11 | QENLGKGF | 0.9972 | 0.6556 | 7 | 15 |
IFT81-ACACB | chr12 | 110647021 | chr12 | 109625804 | 2354 | HLA-B44:26 | AEQENLGKGF | 0.9992 | 0.9534 | 5 | 15 |
IFT81-ACACB | chr12 | 110647021 | chr12 | 109625804 | 2354 | HLA-B44:13 | AEQENLGKGF | 0.9992 | 0.9534 | 5 | 15 |
IFT81-ACACB | chr12 | 110647021 | chr12 | 109625804 | 2354 | HLA-B44:07 | AEQENLGKGF | 0.9992 | 0.9534 | 5 | 15 |
IFT81-ACACB | chr12 | 110647021 | chr12 | 109625804 | 2354 | HLA-B15:53 | AEQENLGKGF | 0.997 | 0.6398 | 5 | 15 |
IFT81-ACACB | chr12 | 110647021 | chr12 | 109625804 | 2354 | HLA-B41:03 | AEQENLGKGF | 0.914 | 0.5267 | 5 | 15 |
Top |
Potential FusionNeoAntigen Information of IFT81-ACACB in HLA II |
![]() |
IFT81-ACACB_110647021_109625804.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
IFT81-ACACB | chr12 | 110647021 | chr12 | 109625804 | 2354 | DRB1-0902 | GKGFKPSSGTVQELN | 11 | 26 |
IFT81-ACACB | chr12 | 110647021 | chr12 | 109625804 | 2354 | DRB1-0902 | LGKGFKPSSGTVQEL | 10 | 25 |
IFT81-ACACB | chr12 | 110647021 | chr12 | 109625804 | 2354 | DRB5-0112 | GKGFKPSSGTVQELN | 11 | 26 |
Top |
Fusion breakpoint peptide structures of IFT81-ACACB |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
2038 | EQENLGKGFKPSSG | IFT81 | ACACB | chr12 | 110647021 | chr12 | 109625804 | 2354 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of IFT81-ACACB |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 2038 | EQENLGKGFKPSSG | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 2038 | EQENLGKGFKPSSG | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 2038 | EQENLGKGFKPSSG | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 2038 | EQENLGKGFKPSSG | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 2038 | EQENLGKGFKPSSG | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 2038 | EQENLGKGFKPSSG | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 2038 | EQENLGKGFKPSSG | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 2038 | EQENLGKGFKPSSG | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 2038 | EQENLGKGFKPSSG | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 2038 | EQENLGKGFKPSSG | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 2038 | EQENLGKGFKPSSG | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of IFT81-ACACB |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
IFT81-ACACB | chr12 | 110647021 | chr12 | 109625804 | 5 | 15 | AEQENLGKGF | GCTGAACAAGAAAACCTTGGAAAGGGTTTT |
IFT81-ACACB | chr12 | 110647021 | chr12 | 109625804 | 7 | 15 | QENLGKGF | CAAGAAAACCTTGGAAAGGGTTTT |
IFT81-ACACB | chr12 | 110647021 | chr12 | 109625804 | 7 | 17 | QENLGKGFKP | CAAGAAAACCTTGGAAAGGGTTTTAAGCCG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
IFT81-ACACB | chr12 | 110647021 | chr12 | 109625804 | 10 | 25 | LGKGFKPSSGTVQEL | CTTGGAAAGGGTTTTAAGCCGAGCTCCGGGACTGTCCAGGAACTG |
IFT81-ACACB | chr12 | 110647021 | chr12 | 109625804 | 11 | 26 | GKGFKPSSGTVQELN | GGAAAGGGTTTTAAGCCGAGCTCCGGGACTGTCCAGGAACTGAAT |
Top |
Information of the samples that have these potential fusion neoantigens of IFT81-ACACB |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
PRAD | IFT81-ACACB | chr12 | 110647021 | ENST00000242591 | chr12 | 109625804 | ENST00000338432 | TCGA-KK-A8ID-01A |
Top |
Potential target of CAR-T therapy development for IFT81-ACACB |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to IFT81-ACACB |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to IFT81-ACACB |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |