|
Fusion Protein:IGF1R-ARID1B |
Fusion Gene and Fusion Protein Summary |
Fusion gene summary |
Fusion partner gene information | Fusion gene name: IGF1R-ARID1B | FusionPDB ID: 38471 | FusionGDB2.0 ID: 38471 | Hgene | Tgene | Gene symbol | IGF1R | ARID1B | Gene ID | 3480 | 57492 |
Gene name | insulin like growth factor 1 receptor | AT-rich interaction domain 1B | |
Synonyms | CD221|IGFIR|IGFR|JTK13 | 6A3-5|BAF250B|BRIGHT|CSS1|DAN15|ELD/OSA1|MRD12|OSA2|P250R | |
Cytomap | 15q26.3 | 6q25.3 | |
Type of gene | protein-coding | protein-coding | |
Description | insulin-like growth factor 1 receptorIGF-I receptorsoluble IGF1R variant 1soluble IGF1R variant 2 | AT-rich interactive domain-containing protein 1BARID domain-containing protein 1BAT rich interactive domain 1B (SWI1-like)BRG1-associated factor 250bBRG1-binding protein ELD/OSA1ELD (eyelid)/OSA protein | |
Modification date | 20200329 | 20200320 | |
UniProtAcc | P08069 Main function of 5'-partner protein: FUNCTION: Receptor tyrosine kinase which mediates actions of insulin-like growth factor 1 (IGF1). Binds IGF1 with high affinity and IGF2 and insulin (INS) with a lower affinity. The activated IGF1R is involved in cell growth and survival control. IGF1R is crucial for tumor transformation and survival of malignant cell. Ligand binding activates the receptor kinase, leading to receptor autophosphorylation, and tyrosines phosphorylation of multiple substrates, that function as signaling adapter proteins including, the insulin-receptor substrates (IRS1/2), Shc and 14-3-3 proteins. Phosphorylation of IRSs proteins lead to the activation of two main signaling pathways: the PI3K-AKT/PKB pathway and the Ras-MAPK pathway. The result of activating the MAPK pathway is increased cellular proliferation, whereas activating the PI3K pathway inhibits apoptosis and stimulates protein synthesis. Phosphorylated IRS1 can activate the 85 kDa regulatory subunit of PI3K (PIK3R1), leading to activation of several downstream substrates, including protein AKT/PKB. AKT phosphorylation, in turn, enhances protein synthesis through mTOR activation and triggers the antiapoptotic effects of IGFIR through phosphorylation and inactivation of BAD. In parallel to PI3K-driven signaling, recruitment of Grb2/SOS by phosphorylated IRS1 or Shc leads to recruitment of Ras and activation of the ras-MAPK pathway. In addition to these two main signaling pathways IGF1R signals also through the Janus kinase/signal transducer and activator of transcription pathway (JAK/STAT). Phosphorylation of JAK proteins can lead to phosphorylation/activation of signal transducers and activators of transcription (STAT) proteins. In particular activation of STAT3, may be essential for the transforming activity of IGF1R. The JAK/STAT pathway activates gene transcription and may be responsible for the transforming activity. JNK kinases can also be activated by the IGF1R. IGF1 exerts inhibiting activities on JNK activation via phosphorylation and inhibition of MAP3K5/ASK1, which is able to directly associate with the IGF1R.; FUNCTION: When present in a hybrid receptor with INSR, binds IGF1. PubMed:12138094 shows that hybrid receptors composed of IGF1R and INSR isoform Long are activated with a high affinity by IGF1, with low affinity by IGF2 and not significantly activated by insulin, and that hybrid receptors composed of IGF1R and INSR isoform Short are activated by IGF1, IGF2 and insulin. In contrast, PubMed:16831875 shows that hybrid receptors composed of IGF1R and INSR isoform Long and hybrid receptors composed of IGF1R and INSR isoform Short have similar binding characteristics, both bind IGF1 and have a low affinity for insulin. | Q8NFD5 Main function of 5'-partner protein: FUNCTION: Involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology). Component of SWI/SNF chromatin remodeling complexes that carry out key enzymatic activities, changing chromatin structure by altering DNA-histone contacts within a nucleosome in an ATP-dependent manner. Belongs to the neural progenitors-specific chromatin remodeling complex (npBAF complex) and the neuron-specific chromatin remodeling complex (nBAF complex). During neural development a switch from a stem/progenitor to a postmitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to postmitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain ACTL6A/BAF53A and PHF10/BAF45A, are exchanged for homologous alternative ACTL6B/BAF53B and DPF1/BAF45B or DPF3/BAF45C subunits in neuron-specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth (By similarity). Binds DNA non-specifically (PubMed:14982958, PubMed:15170388). {ECO:0000250|UniProtKB:E9Q4N7, ECO:0000269|PubMed:14982958, ECO:0000269|PubMed:15170388, ECO:0000303|PubMed:12672490, ECO:0000303|PubMed:22952240, ECO:0000303|PubMed:26601204}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000268035, ENST00000558762, ENST00000560432, | ENST00000478761, ENST00000275248, ENST00000346085, ENST00000350026, ENST00000367148, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 24 X 15 X 6=2160 | 10 X 12 X 6=720 |
# samples | 25 | 12 | |
** MAII score | log2(25/2160*10)=-3.11103131238874 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(12/720*10)=-2.58496250072116 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: IGF1R [Title/Abstract] AND ARID1B [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: IGF1R [Title/Abstract] AND ARID1B [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | IGF1R(99251336)-ARID1B(157469758), # samples:3 | ||
Anticipated loss of major functional domain due to fusion event. | IGF1R-ARID1B seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. IGF1R-ARID1B seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. IGF1R-ARID1B seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. IGF1R-ARID1B seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | IGF1R | GO:0043066 | negative regulation of apoptotic process | 12556535 |
Hgene | IGF1R | GO:0046328 | regulation of JNK cascade | 12556535 |
Hgene | IGF1R | GO:0046777 | protein autophosphorylation | 1846292|7679099|11162456 |
Hgene | IGF1R | GO:0048009 | insulin-like growth factor receptor signaling pathway | 7679099 |
Hgene | IGF1R | GO:0048015 | phosphatidylinositol-mediated signaling | 7692086 |
Hgene | IGF1R | GO:0051389 | inactivation of MAPKK activity | 12556535 |
Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr15:99251336/chr6:157469758) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
Fusion gene breakpoints across IGF1R (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
Fusion gene breakpoints across ARID1B (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
Top |
Fusion Amino Acid Sequences |
Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000268035 | IGF1R | chr15 | 99251336 | + | ENST00000350026 | ARID1B | chr6 | 157469758 | + | 6709 | 1251 | 611 | 5449 | 1612 |
ENST00000268035 | IGF1R | chr15 | 99251336 | + | ENST00000346085 | ARID1B | chr6 | 157469758 | + | 8338 | 1251 | 611 | 5449 | 1612 |
ENST00000268035 | IGF1R | chr15 | 99251336 | + | ENST00000367148 | ARID1B | chr6 | 157469758 | + | 6985 | 1251 | 611 | 5608 | 1665 |
ENST00000268035 | IGF1R | chr15 | 99251336 | + | ENST00000275248 | ARID1B | chr6 | 157469758 | + | 6985 | 1251 | 611 | 5608 | 1665 |
ENST00000558762 | IGF1R | chr15 | 99251336 | + | ENST00000350026 | ARID1B | chr6 | 157469758 | + | 6636 | 1178 | 538 | 5376 | 1612 |
ENST00000558762 | IGF1R | chr15 | 99251336 | + | ENST00000346085 | ARID1B | chr6 | 157469758 | + | 8265 | 1178 | 538 | 5376 | 1612 |
ENST00000558762 | IGF1R | chr15 | 99251336 | + | ENST00000367148 | ARID1B | chr6 | 157469758 | + | 6912 | 1178 | 538 | 5535 | 1665 |
ENST00000558762 | IGF1R | chr15 | 99251336 | + | ENST00000275248 | ARID1B | chr6 | 157469758 | + | 6912 | 1178 | 538 | 5535 | 1665 |
DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000268035 | ENST00000350026 | IGF1R | chr15 | 99251336 | + | ARID1B | chr6 | 157469758 | + | 0.002961082 | 0.99703896 |
ENST00000268035 | ENST00000346085 | IGF1R | chr15 | 99251336 | + | ARID1B | chr6 | 157469758 | + | 0.001095424 | 0.9989046 |
ENST00000268035 | ENST00000367148 | IGF1R | chr15 | 99251336 | + | ARID1B | chr6 | 157469758 | + | 0.002819619 | 0.99718034 |
ENST00000268035 | ENST00000275248 | IGF1R | chr15 | 99251336 | + | ARID1B | chr6 | 157469758 | + | 0.002819619 | 0.99718034 |
ENST00000558762 | ENST00000350026 | IGF1R | chr15 | 99251336 | + | ARID1B | chr6 | 157469758 | + | 0.002691637 | 0.9973084 |
ENST00000558762 | ENST00000346085 | IGF1R | chr15 | 99251336 | + | ARID1B | chr6 | 157469758 | + | 0.001014489 | 0.99898547 |
ENST00000558762 | ENST00000367148 | IGF1R | chr15 | 99251336 | + | ARID1B | chr6 | 157469758 | + | 0.002552976 | 0.997447 |
ENST00000558762 | ENST00000275248 | IGF1R | chr15 | 99251336 | + | ARID1B | chr6 | 157469758 | + | 0.002552976 | 0.997447 |
Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for IGF1R-ARID1B |
+/-13 AA sequence from the breakpoints of the fusion protein sequences. |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
IGF1R | chr15 | 99251336 | ARID1B | chr6 | 157469758 | 1178 | 214 | NYRCWTTNRCQKSNYSRPPAYSGVPS |
IGF1R | chr15 | 99251336 | ARID1B | chr6 | 157469758 | 1251 | 214 | NYRCWTTNRCQKSNYSRPPAYSGVPS |
Top |
Potential FusionNeoAntigen Information of IGF1R-ARID1B in HLA I |
Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
IGF1R-ARID1B_99251336_157469758.msa |
Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B15:25 | SNYSRPPAY | 0.9877 | 0.6943 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-A30:08 | KSNYSRPPA | 0.9811 | 0.5335 | 11 | 20 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B15:02 | SNYSRPPAY | 0.9795 | 0.7005 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B15:03 | SNYSRPPAY | 0.7795 | 0.5128 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B18:01 | SNYSRPPAY | 0.1129 | 0.7753 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B15:25 | KSNYSRPPAY | 0.9932 | 0.7481 | 11 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B15:17 | KSNYSRPPAY | 0.9874 | 0.7236 | 11 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-A30:08 | KSNYSRPPAY | 0.9582 | 0.5434 | 11 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B15:03 | QKSNYSRPPAY | 0.9877 | 0.5141 | 10 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B15:21 | SNYSRPPAY | 0.9761 | 0.6723 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B15:05 | SNYSRPPAY | 0.9753 | 0.5909 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B15:31 | SNYSRPPAY | 0.9504 | 0.5974 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C12:16 | SNYSRPPAY | 0.8084 | 0.8112 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B15:04 | SNYSRPPAY | 0.795 | 0.7285 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C15:04 | SNYSRPPAY | 0.7892 | 0.6292 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C07:67 | SNYSRPPAY | 0.7863 | 0.7214 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C07:80 | SNYSRPPAY | 0.7863 | 0.7214 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C07:46 | SNYSRPPAY | 0.7836 | 0.6114 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C07:10 | SNYSRPPAY | 0.7736 | 0.7757 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C07:27 | SNYSRPPAY | 0.7136 | 0.7865 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C07:05 | SNYSRPPAY | 0.6868 | 0.8062 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C03:14 | SNYSRPPAY | 0.3717 | 0.8405 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C12:12 | SNYSRPPAY | 0.2209 | 0.7653 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C12:04 | SNYSRPPAY | 0.2087 | 0.9444 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C06:03 | SNYSRPPAY | 0.2014 | 0.9296 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B15:07 | KSNYSRPPAY | 0.9959 | 0.5262 | 11 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C15:04 | KSNYSRPPAY | 0.9882 | 0.6377 | 11 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B15:27 | SNYSRPPAY | 0.9931 | 0.699 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B15:50 | SNYSRPPAY | 0.9907 | 0.636 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B15:11 | SNYSRPPAY | 0.9907 | 0.6531 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B15:39 | SNYSRPPAY | 0.9889 | 0.5836 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B35:43 | SNYSRPPAY | 0.987 | 0.6473 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-A30:01 | KSNYSRPPA | 0.9832 | 0.6607 | 11 | 20 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B15:20 | SNYSRPPAY | 0.9727 | 0.6785 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B35:28 | SNYSRPPAY | 0.9591 | 0.6883 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B15:35 | SNYSRPPAY | 0.9547 | 0.6587 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B15:12 | SNYSRPPAY | 0.954 | 0.7382 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B35:20 | SNYSRPPAY | 0.936 | 0.698 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B15:53 | SNYSRPPAY | 0.918 | 0.6557 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C07:17 | SNYSRPPAY | 0.8704 | 0.8058 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C15:09 | SNYSRPPAY | 0.7892 | 0.6292 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C07:02 | SNYSRPPAY | 0.7863 | 0.7214 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B18:11 | SNYSRPPAY | 0.7808 | 0.6552 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C03:02 | SNYSRPPAY | 0.7365 | 0.8127 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B15:54 | SNYSRPPAY | 0.7307 | 0.6448 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B48:02 | SNYSRPPAY | 0.649 | 0.663 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C12:02 | SNYSRPPAY | 0.569 | 0.8223 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C16:04 | SNYSRPPAY | 0.5549 | 0.8496 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B18:04 | SNYSRPPAY | 0.432 | 0.8002 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C16:01 | SNYSRPPAY | 0.3197 | 0.8974 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C16:02 | SNYSRPPAY | 0.3122 | 0.9484 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C06:02 | SNYSRPPAY | 0.3099 | 0.9392 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C06:17 | SNYSRPPAY | 0.3099 | 0.9392 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C12:03 | SNYSRPPAY | 0.275 | 0.8502 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C06:06 | SNYSRPPAY | 0.2308 | 0.932 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B18:07 | SNYSRPPAY | 0.1513 | 0.6882 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B18:03 | SNYSRPPAY | 0.1338 | 0.7624 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B18:06 | SNYSRPPAY | 0.133 | 0.7697 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B18:05 | SNYSRPPAY | 0.1129 | 0.7753 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B18:08 | SNYSRPPAY | 0.1007 | 0.643 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C06:08 | SNYSRPPAY | 0.0207 | 0.9077 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C02:02 | SNYSRPPAY | 0.0051 | 0.8641 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C02:10 | SNYSRPPAY | 0.0051 | 0.8641 | 12 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B15:35 | KSNYSRPPAY | 0.9956 | 0.7128 | 11 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B15:39 | KSNYSRPPAY | 0.9931 | 0.6575 | 11 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-B58:06 | KSNYSRPPAY | 0.9883 | 0.549 | 11 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C15:09 | KSNYSRPPAY | 0.9882 | 0.6377 | 11 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-A30:01 | KSNYSRPPAY | 0.9593 | 0.64 | 11 | 21 |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 | HLA-C16:02 | KSNYSRPPAY | 0.9013 | 0.9574 | 11 | 21 |
Top |
Potential FusionNeoAntigen Information of IGF1R-ARID1B in HLA II |
Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of IGF1R-ARID1B |
3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
9527 | TNRCQKSNYSRPPA | IGF1R | ARID1B | chr15 | 99251336 | chr6 | 157469758 | 1251 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of IGF1R-ARID1B |
Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 9527 | TNRCQKSNYSRPPA | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 9527 | TNRCQKSNYSRPPA | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 9527 | TNRCQKSNYSRPPA | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 9527 | TNRCQKSNYSRPPA | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 9527 | TNRCQKSNYSRPPA | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 9527 | TNRCQKSNYSRPPA | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 9527 | TNRCQKSNYSRPPA | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 9527 | TNRCQKSNYSRPPA | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 9527 | TNRCQKSNYSRPPA | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 9527 | TNRCQKSNYSRPPA | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 9527 | TNRCQKSNYSRPPA | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of IGF1R-ARID1B |
mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 10 | 21 | QKSNYSRPPAY | GCCAGAAAAGTAACTACTCCAGACCCCCAGCGT |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 11 | 20 | KSNYSRPPA | AGAAAAGTAACTACTCCAGACCCCCAG |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 11 | 21 | KSNYSRPPAY | AGAAAAGTAACTACTCCAGACCCCCAGCGT |
IGF1R-ARID1B | chr15 | 99251336 | chr6 | 157469758 | 12 | 21 | SNYSRPPAY | AAAGTAACTACTCCAGACCCCCAGCGT |
mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of IGF1R-ARID1B |
These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
BRCA | IGF1R-ARID1B | chr15 | 99251336 | ENST00000268035 | chr6 | 157469758 | ENST00000275248 | TCGA-E9-A1NF-01A |
Top |
Potential target of CAR-T therapy development for IGF1R-ARID1B |
Predicted 3D structure. We used RoseTTAFold. |
Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to IGF1R-ARID1B |
Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to IGF1R-ARID1B |
Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
Diseases associated with fusion partners. (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |