![]() |
|||||||
|
Fusion Protein:ALDH5A1-MAP3K5 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: ALDH5A1-MAP3K5 | FusionPDB ID: 3917 | FusionGDB2.0 ID: 3917 | Hgene | Tgene | Gene symbol | ALDH5A1 | MAP3K5 | Gene ID | 7915 | 4217 |
Gene name | aldehyde dehydrogenase 5 family member A1 | mitogen-activated protein kinase kinase kinase 5 | |
Synonyms | SSADH|SSDH | ASK1|MAPKKK5|MEKK5 | |
Cytomap | 6p22.3 | 6q23.3 | |
Type of gene | protein-coding | protein-coding | |
Description | succinate-semialdehyde dehydrogenase, mitochondrialNAD(+)-dependent succinic semialdehyde dehydrogenasemitochondrial succinate semialdehyde dehydrogenase | mitogen-activated protein kinase kinase kinase 5ASK-1MAP/ERK kinase kinase 5MAPK/ERK kinase kinase 5MEK kinase 5MEKK 5apoptosis signal-regulating kinase 1 | |
Modification date | 20200313 | 20200327 | |
UniProtAcc | P51649 Main function of 5'-partner protein: FUNCTION: Catalyzes one step in the degradation of the inhibitory neurotransmitter gamma-aminobutyric acid (GABA). {ECO:0000269|PubMed:19300440}. | Q99683 Main function of 5'-partner protein: FUNCTION: Serine/threonine kinase which acts as an essential component of the MAP kinase signal transduction pathway. Plays an important role in the cascades of cellular responses evoked by changes in the environment. Mediates signaling for determination of cell fate such as differentiation and survival. Plays a crucial role in the apoptosis signal transduction pathway through mitochondria-dependent caspase activation. MAP3K5/ASK1 is required for the innate immune response, which is essential for host defense against a wide range of pathogens. Mediates signal transduction of various stressors like oxidative stress as well as by receptor-mediated inflammatory signals, such as the tumor necrosis factor (TNF) or lipopolysaccharide (LPS). Once activated, acts as an upstream activator of the MKK/JNK signal transduction cascade and the p38 MAPK signal transduction cascade through the phosphorylation and activation of several MAP kinase kinases like MAP2K4/SEK1, MAP2K3/MKK3, MAP2K6/MKK6 and MAP2K7/MKK7. These MAP2Ks in turn activate p38 MAPKs and c-jun N-terminal kinases (JNKs). Both p38 MAPK and JNKs control the transcription factors activator protein-1 (AP-1). {ECO:0000269|PubMed:10411906, ECO:0000269|PubMed:10688666, ECO:0000269|PubMed:10849426, ECO:0000269|PubMed:11029458, ECO:0000269|PubMed:11154276, ECO:0000269|PubMed:11689443, ECO:0000269|PubMed:11920685, ECO:0000269|PubMed:12697749, ECO:0000269|PubMed:14688258, ECO:0000269|PubMed:14749717, ECO:0000269|PubMed:15023544, ECO:0000269|PubMed:16129676, ECO:0000269|PubMed:17220297, ECO:0000269|PubMed:23102700, ECO:0000269|PubMed:26095851, ECO:0000269|PubMed:8940179, ECO:0000269|PubMed:8974401, ECO:0000269|PubMed:9564042, ECO:0000269|PubMed:9774977}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000348925, ENST00000357578, ENST00000491546, ENST00000546278, | ENST00000463140, ENST00000355845, ENST00000359015, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 2 X 2 X 2=8 | 17 X 18 X 7=2142 |
# samples | 2 | 18 | |
** MAII score | log2(2/8*10)=1.32192809488736 | log2(18/2142*10)=-3.57288966842058 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: ALDH5A1 [Title/Abstract] AND MAP3K5 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: ALDH5A1 [Title/Abstract] AND MAP3K5 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | ALDH5A1(24505213)-MAP3K5(136880014), # samples:3 | ||
Anticipated loss of major functional domain due to fusion event. | ALDH5A1-MAP3K5 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ALDH5A1-MAP3K5 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | ALDH5A1 | GO:0009450 | gamma-aminobutyric acid catabolic process | 9683595 |
Tgene | MAP3K5 | GO:0000165 | MAPK cascade | 17210579|21771788 |
Tgene | MAP3K5 | GO:0000186 | activation of MAPKK activity | 11959862 |
Tgene | MAP3K5 | GO:0006468 | protein phosphorylation | 11096076|15983381 |
Tgene | MAP3K5 | GO:0007254 | JNK cascade | 21771788 |
Tgene | MAP3K5 | GO:0008631 | intrinsic apoptotic signaling pathway in response to oxidative stress | 21771788 |
Tgene | MAP3K5 | GO:0034198 | cellular response to amino acid starvation | 11096076 |
Tgene | MAP3K5 | GO:0043065 | positive regulation of apoptotic process | 21771788 |
Tgene | MAP3K5 | GO:0043280 | positive regulation of cysteine-type endopeptidase activity involved in apoptotic process | 20674765 |
Tgene | MAP3K5 | GO:0045893 | positive regulation of transcription, DNA-templated | 11096076 |
Tgene | MAP3K5 | GO:0051403 | stress-activated MAPK cascade | 11096076 |
Tgene | MAP3K5 | GO:0070301 | cellular response to hydrogen peroxide | 20674765 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr6:24505213/chr6:136880014) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000546278 | ALDH5A1 | chr6 | 24505213 | + | ENST00000359015 | MAP3K5 | chr6 | 136880014 | - | 1378 | 529 | 7 | 666 | 219 |
ENST00000546278 | ALDH5A1 | chr6 | 24505213 | + | ENST00000355845 | MAP3K5 | chr6 | 136880014 | - | 1200 | 529 | 7 | 666 | 219 |
ENST00000357578 | ALDH5A1 | chr6 | 24505213 | + | ENST00000359015 | MAP3K5 | chr6 | 136880014 | - | 1720 | 871 | 7 | 1008 | 333 |
ENST00000357578 | ALDH5A1 | chr6 | 24505213 | + | ENST00000355845 | MAP3K5 | chr6 | 136880014 | - | 1542 | 871 | 7 | 1008 | 333 |
ENST00000491546 | ALDH5A1 | chr6 | 24505213 | + | ENST00000359015 | MAP3K5 | chr6 | 136880014 | - | 1621 | 772 | 70 | 909 | 279 |
ENST00000491546 | ALDH5A1 | chr6 | 24505213 | + | ENST00000355845 | MAP3K5 | chr6 | 136880014 | - | 1443 | 772 | 70 | 909 | 279 |
ENST00000348925 | ALDH5A1 | chr6 | 24505213 | + | ENST00000359015 | MAP3K5 | chr6 | 136880014 | - | 1603 | 754 | 28 | 891 | 287 |
ENST00000348925 | ALDH5A1 | chr6 | 24505213 | + | ENST00000355845 | MAP3K5 | chr6 | 136880014 | - | 1425 | 754 | 28 | 891 | 287 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000546278 | ENST00000359015 | ALDH5A1 | chr6 | 24505213 | + | MAP3K5 | chr6 | 136880014 | - | 0.000477408 | 0.99952257 |
ENST00000546278 | ENST00000355845 | ALDH5A1 | chr6 | 24505213 | + | MAP3K5 | chr6 | 136880014 | - | 0.000823048 | 0.9991769 |
ENST00000357578 | ENST00000359015 | ALDH5A1 | chr6 | 24505213 | + | MAP3K5 | chr6 | 136880014 | - | 0.004945873 | 0.9950541 |
ENST00000357578 | ENST00000355845 | ALDH5A1 | chr6 | 24505213 | + | MAP3K5 | chr6 | 136880014 | - | 0.011168723 | 0.9888313 |
ENST00000491546 | ENST00000359015 | ALDH5A1 | chr6 | 24505213 | + | MAP3K5 | chr6 | 136880014 | - | 0.011413986 | 0.988586 |
ENST00000491546 | ENST00000355845 | ALDH5A1 | chr6 | 24505213 | + | MAP3K5 | chr6 | 136880014 | - | 0.02959773 | 0.9704023 |
ENST00000348925 | ENST00000359015 | ALDH5A1 | chr6 | 24505213 | + | MAP3K5 | chr6 | 136880014 | - | 0.003805622 | 0.99619436 |
ENST00000348925 | ENST00000355845 | ALDH5A1 | chr6 | 24505213 | + | MAP3K5 | chr6 | 136880014 | - | 0.009343077 | 0.99065685 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for ALDH5A1-MAP3K5 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
ALDH5A1 | chr6 | 24505213 | MAP3K5 | chr6 | 136880014 | 529 | 174 | AEDTPFSALALAEFLAEDYTLLDVLY |
ALDH5A1 | chr6 | 24505213 | MAP3K5 | chr6 | 136880014 | 754 | 242 | AEDTPFSALALAEFLAEDYTLLDVLY |
ALDH5A1 | chr6 | 24505213 | MAP3K5 | chr6 | 136880014 | 772 | 234 | AEDTPFSALALAEFLAEDYTLLDVLY |
ALDH5A1 | chr6 | 24505213 | MAP3K5 | chr6 | 136880014 | 871 | 288 | AEDTPFSALALAEFLAEDYTLLDVLY |
Top |
Potential FusionNeoAntigen Information of ALDH5A1-MAP3K5 in HLA I |
![]() |
ALDH5A1-MAP3K5_24505213_136880014.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B18:01 | AEFLAEDY | 0.9846 | 0.9396 | 11 | 19 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B15:17 | FSALALAEF | 0.9963 | 0.9722 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B46:01 | FSALALAEF | 0.9954 | 0.5841 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B15:16 | FSALALAEF | 0.9931 | 0.9118 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B57:03 | FSALALAEF | 0.9807 | 0.9922 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B15:01 | ALAEFLAEDY | 0.9995 | 0.9219 | 9 | 19 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B39:13 | AEFLAEDYTL | 0.8539 | 0.9595 | 11 | 21 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B35:01 | TPFSALALAEF | 0.999 | 0.8746 | 3 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B35:05 | TPFSALALAEF | 0.9988 | 0.6637 | 3 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B47:01 | AEFLAEDYTLL | 0.9978 | 0.5551 | 11 | 22 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B53:01 | TPFSALALAEF | 0.9957 | 0.6435 | 3 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B39:13 | AEFLAEDYTLL | 0.9572 | 0.9454 | 11 | 22 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-C03:08 | FSALALAEF | 0.9947 | 0.9459 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-C15:04 | FSALALAEF | 0.9902 | 0.9693 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-C03:19 | FSALALAEF | 0.9871 | 0.9962 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-C03:07 | FSALALAEF | 0.9798 | 0.9949 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-C03:14 | FSALALAEF | 0.9636 | 0.9893 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-C12:12 | FSALALAEF | 0.9349 | 0.9512 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-C12:04 | FSALALAEF | 0.912 | 0.9977 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-C02:06 | FSALALAEF | 0.4156 | 0.9943 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B15:07 | ALAEFLAEDY | 0.9979 | 0.7248 | 9 | 19 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B39:08 | AEFLAEDYTL | 0.9272 | 0.8903 | 11 | 21 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B18:08 | AEFLAEDY | 0.9888 | 0.9081 | 11 | 19 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B18:06 | AEFLAEDY | 0.987 | 0.9428 | 11 | 19 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B18:05 | AEFLAEDY | 0.9846 | 0.9396 | 11 | 19 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B18:11 | AEFLAEDY | 0.9807 | 0.9247 | 11 | 19 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-C03:02 | FSALALAEF | 0.9987 | 0.9853 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-C03:04 | FSALALAEF | 0.9977 | 0.995 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-C03:03 | FSALALAEF | 0.9977 | 0.995 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B15:08 | FSALALAEF | 0.9959 | 0.9526 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B35:43 | FSALALAEF | 0.9937 | 0.9534 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B57:02 | FSALALAEF | 0.9908 | 0.9618 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-C15:09 | FSALALAEF | 0.9902 | 0.9693 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-C03:05 | FSALALAEF | 0.9901 | 0.9525 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-C16:04 | FSALALAEF | 0.9884 | 0.9894 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-C03:17 | FSALALAEF | 0.9871 | 0.9847 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-C12:02 | FSALALAEF | 0.9846 | 0.9894 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B35:13 | SALALAEFL | 0.9584 | 0.9173 | 6 | 15 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-C12:03 | FSALALAEF | 0.9502 | 0.9919 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-C16:01 | FSALALAEF | 0.9331 | 0.9904 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-C03:06 | FSALALAEF | 0.7905 | 0.9949 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-C16:02 | FSALALAEF | 0.7565 | 0.9962 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-C02:02 | FSALALAEF | 0.642 | 0.9901 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-C02:10 | FSALALAEF | 0.642 | 0.9901 | 5 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B15:33 | ALAEFLAEDY | 0.9995 | 0.9219 | 9 | 19 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B15:27 | ALAEFLAEDY | 0.9995 | 0.929 | 9 | 19 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B15:125 | ALAEFLAEDY | 0.9995 | 0.9219 | 9 | 19 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B15:34 | ALAEFLAEDY | 0.9995 | 0.9219 | 9 | 19 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B15:50 | ALAEFLAEDY | 0.9995 | 0.9663 | 9 | 19 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B15:135 | ALAEFLAEDY | 0.9994 | 0.9162 | 9 | 19 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B15:35 | ALAEFLAEDY | 0.9976 | 0.918 | 9 | 19 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B40:04 | AEFLAEDYTL | 0.9915 | 0.7067 | 11 | 21 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B41:03 | AEFLAEDYTL | 0.7923 | 0.7442 | 11 | 21 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B35:17 | TPFSALALAEF | 0.999 | 0.8053 | 3 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B35:30 | TPFSALALAEF | 0.999 | 0.8053 | 3 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B35:77 | TPFSALALAEF | 0.999 | 0.8746 | 3 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B40:04 | AEFLAEDYTLL | 0.9989 | 0.6782 | 11 | 22 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B35:24 | TPFSALALAEF | 0.9983 | 0.814 | 3 | 14 |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 | HLA-B41:03 | AEFLAEDYTLL | 0.9294 | 0.6703 | 11 | 22 |
Top |
Potential FusionNeoAntigen Information of ALDH5A1-MAP3K5 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of ALDH5A1-MAP3K5 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
8400 | SALALAEFLAEDYT | ALDH5A1 | MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 754 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ALDH5A1-MAP3K5 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 8400 | SALALAEFLAEDYT | -6.15779 | -7.19309 |
HLA-B14:02 | 3BVN | 8400 | SALALAEFLAEDYT | -5.42154 | -5.53494 |
HLA-B52:01 | 3W39 | 8400 | SALALAEFLAEDYT | -6.31003 | -7.34533 |
HLA-B52:01 | 3W39 | 8400 | SALALAEFLAEDYT | -5.72549 | -5.83889 |
HLA-A11:01 | 4UQ2 | 8400 | SALALAEFLAEDYT | -10.3617 | -10.4751 |
HLA-A11:01 | 4UQ2 | 8400 | SALALAEFLAEDYT | -6.62574 | -7.66104 |
HLA-A24:02 | 5HGA | 8400 | SALALAEFLAEDYT | -7.32817 | -7.44157 |
HLA-A24:02 | 5HGA | 8400 | SALALAEFLAEDYT | -5.51285 | -6.54815 |
HLA-B44:05 | 3DX8 | 8400 | SALALAEFLAEDYT | -6.27581 | -7.31111 |
HLA-B44:05 | 3DX8 | 8400 | SALALAEFLAEDYT | -5.0724 | -5.1858 |
HLA-A02:01 | 6TDR | 8400 | SALALAEFLAEDYT | -2.75053 | -2.86393 |
Top |
Vaccine Design for the FusionNeoAntigens of ALDH5A1-MAP3K5 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 11 | 19 | AEFLAEDY | GCTGAGTTTTTGGCTGAAGATTAT |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 11 | 21 | AEFLAEDYTL | GCTGAGTTTTTGGCTGAAGATTATACACTA |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 11 | 22 | AEFLAEDYTLL | GCTGAGTTTTTGGCTGAAGATTATACACTATTG |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 3 | 14 | TPFSALALAEF | ACGCCCTTCTCCGCCCTGGCCCTGGCTGAGTTT |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 5 | 14 | FSALALAEF | TTCTCCGCCCTGGCCCTGGCTGAGTTT |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 6 | 15 | SALALAEFL | TCCGCCCTGGCCCTGGCTGAGTTTTTG |
ALDH5A1-MAP3K5 | chr6 | 24505213 | chr6 | 136880014 | 9 | 19 | ALAEFLAEDY | GCCCTGGCTGAGTTTTTGGCTGAAGATTAT |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of ALDH5A1-MAP3K5 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
LUAD | ALDH5A1-MAP3K5 | chr6 | 24505213 | ENST00000348925 | chr6 | 136880014 | ENST00000355845 | TCGA-69-7980-01A |
Top |
Potential target of CAR-T therapy development for ALDH5A1-MAP3K5 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to ALDH5A1-MAP3K5 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to ALDH5A1-MAP3K5 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |