Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:IKZF1-LRBA

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: IKZF1-LRBA
	FusionPDB ID: 39390
	FusionGDB2.0 ID: 39390
		Hgene	Tgene
	Gene symbol	IKZF1	LRBA
	Gene ID	10320	987
	Gene name	IKAROS family zinc finger 1	LPS responsive beige-like anchor protein
	Synonyms	CVID13\|Hs.54452\|IK1\|IKAROS\|LYF1\|LyF-1\|PPP1R92\|PRO0758\|ZNFN1A1	BGL\|CDC4L\|CVID8\|LAB300\|LBA
	Cytomap	7p12.2	4q31.3
	Type of gene	protein-coding	protein-coding
	Description	DNA-binding protein IkarosCLL-associated antigen KW-6ikaros family zinc finger protein 1lymphoid transcription factor LyF-1protein phosphatase 1, regulatory subunit 92zinc finger protein, subfamily 1A, 1 (Ikaros)	lipopolysaccharide-responsive and beige-like anchor proteinCDC4-like proteinLPS-responsive vesicle trafficking, beach and anchor containingvesicle trafficking, beach and anchor containing
	Modification date	20200329	20200320
	UniProtAcc	Q13422 Main function of 5'-partner protein: FUNCTION: Transcription regulator of hematopoietic cell differentiation (PubMed:17934067). Binds gamma-satellite DNA (PubMed:17135265, PubMed:19141594). Plays a role in the development of lymphocytes, B- and T-cells. Binds and activates the enhancer (delta-A element) of the CD3-delta gene. Repressor of the TDT (fikzfterminal deoxynucleotidyltransferase) gene during thymocyte differentiation. Regulates transcription through association with both HDAC-dependent and HDAC-independent complexes. Targets the 2 chromatin-remodeling complexes, NuRD and BAF (SWI/SNF), in a single complex (PYR complex), to the beta-globin locus in adult erythrocytes. Increases normal apoptosis in adult erythroid cells. Confers early temporal competence to retinal progenitor cells (RPCs) (By similarity). Function is isoform-specific and is modulated by dominant-negative inactive isoforms (PubMed:17135265, PubMed:17934067). {ECO:0000250\|UniProtKB:Q03267, ECO:0000269\|PubMed:10204490, ECO:0000269\|PubMed:17135265, ECO:0000269\|PubMed:17934067, ECO:0000269\|PubMed:19141594}.	P50851 Main function of 5'-partner protein: FUNCTION: May be involved in coupling signal transduction and vesicle trafficking to enable polarized secretion and/or membrane deposition of immune effector molecules. {ECO:0000250}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000492782, ENST00000331340, ENST00000343574, ENST00000346667, ENST00000349824, ENST00000357364, ENST00000359197, ENST00000413698, ENST00000438033, ENST00000439701, ENST00000440768,	ENST00000510413, ENST00000535741, ENST00000357115, ENST00000503716, ENST00000507224,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	8 X 7 X 6=336	25 X 25 X 10=6250
	# samples	8	27
	** MAII score	log2(8/336*10)=-2.0703893278914 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(27/6250*10)=-4.53282487738598 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: IKZF1 [Title/Abstract] AND LRBA [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: IKZF1 [Title/Abstract] AND LRBA [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	IKZF1(50367353)-LRBA(151207186), # samples:3
Anticipated loss of major functional domain due to fusion event.	IKZF1-LRBA seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. IKZF1-LRBA seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr7:50367353/chr4:151207186)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across IKZF1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across LRBA (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000440768	IKZF1	chr7	50367353	+	ENST00000535741	LRBA	chr4	151207186	-	2137	315	53	856	267
ENST00000440768	IKZF1	chr7	50367353	+	ENST00000510413	LRBA	chr4	151207186	-	2048	315	53	856	267
ENST00000359197	IKZF1	chr7	50367353	+	ENST00000535741	LRBA	chr4	151207186	-	2137	315	53	856	267
ENST00000359197	IKZF1	chr7	50367353	+	ENST00000510413	LRBA	chr4	151207186	-	2048	315	53	856	267
ENST00000343574	IKZF1	chr7	50367353	+	ENST00000535741	LRBA	chr4	151207186	-	2137	315	53	856	267
ENST00000343574	IKZF1	chr7	50367353	+	ENST00000510413	LRBA	chr4	151207186	-	2048	315	53	856	267
ENST00000331340	IKZF1	chr7	50367353	+	ENST00000535741	LRBA	chr4	151207186	-	2137	315	53	856	267
ENST00000331340	IKZF1	chr7	50367353	+	ENST00000510413	LRBA	chr4	151207186	-	2048	315	53	856	267
ENST00000349824	IKZF1	chr7	50367353	+	ENST00000535741	LRBA	chr4	151207186	-	2137	315	53	856	267
ENST00000349824	IKZF1	chr7	50367353	+	ENST00000510413	LRBA	chr4	151207186	-	2048	315	53	856	267
ENST00000357364	IKZF1	chr7	50367353	+	ENST00000535741	LRBA	chr4	151207186	-	2137	315	53	856	267
ENST00000357364	IKZF1	chr7	50367353	+	ENST00000510413	LRBA	chr4	151207186	-	2048	315	53	856	267
ENST00000346667	IKZF1	chr7	50367353	+	ENST00000535741	LRBA	chr4	151207186	-	2137	315	53	856	267
ENST00000346667	IKZF1	chr7	50367353	+	ENST00000510413	LRBA	chr4	151207186	-	2048	315	53	856	267
ENST00000438033	IKZF1	chr7	50367353	+	ENST00000535741	LRBA	chr4	151207186	-	2182	360	128	901	257
ENST00000438033	IKZF1	chr7	50367353	+	ENST00000510413	LRBA	chr4	151207186	-	2093	360	128	901	257
ENST00000439701	IKZF1	chr7	50367353	+	ENST00000535741	LRBA	chr4	151207186	-	2181	359	127	900	257
ENST00000439701	IKZF1	chr7	50367353	+	ENST00000510413	LRBA	chr4	151207186	-	2092	359	127	900	257
ENST00000413698	IKZF1	chr7	50367353	+	ENST00000535741	LRBA	chr4	151207186	-	2191	369	29	910	293
ENST00000413698	IKZF1	chr7	50367353	+	ENST00000510413	LRBA	chr4	151207186	-	2102	369	29	910	293

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000440768	ENST00000535741	IKZF1	chr7	50367353	+	LRBA	chr4	151207186	-	0.000692189	0.99930775
ENST00000440768	ENST00000510413	IKZF1	chr7	50367353	+	LRBA	chr4	151207186	-	0.000753531	0.9992465
ENST00000359197	ENST00000535741	IKZF1	chr7	50367353	+	LRBA	chr4	151207186	-	0.000692189	0.99930775
ENST00000359197	ENST00000510413	IKZF1	chr7	50367353	+	LRBA	chr4	151207186	-	0.000753531	0.9992465
ENST00000343574	ENST00000535741	IKZF1	chr7	50367353	+	LRBA	chr4	151207186	-	0.000692189	0.99930775
ENST00000343574	ENST00000510413	IKZF1	chr7	50367353	+	LRBA	chr4	151207186	-	0.000753531	0.9992465
ENST00000331340	ENST00000535741	IKZF1	chr7	50367353	+	LRBA	chr4	151207186	-	0.000692189	0.99930775
ENST00000331340	ENST00000510413	IKZF1	chr7	50367353	+	LRBA	chr4	151207186	-	0.000753531	0.9992465
ENST00000349824	ENST00000535741	IKZF1	chr7	50367353	+	LRBA	chr4	151207186	-	0.000692189	0.99930775
ENST00000349824	ENST00000510413	IKZF1	chr7	50367353	+	LRBA	chr4	151207186	-	0.000753531	0.9992465
ENST00000357364	ENST00000535741	IKZF1	chr7	50367353	+	LRBA	chr4	151207186	-	0.000692189	0.99930775
ENST00000357364	ENST00000510413	IKZF1	chr7	50367353	+	LRBA	chr4	151207186	-	0.000753531	0.9992465
ENST00000346667	ENST00000535741	IKZF1	chr7	50367353	+	LRBA	chr4	151207186	-	0.000692189	0.99930775
ENST00000346667	ENST00000510413	IKZF1	chr7	50367353	+	LRBA	chr4	151207186	-	0.000753531	0.9992465
ENST00000438033	ENST00000535741	IKZF1	chr7	50367353	+	LRBA	chr4	151207186	-	0.000615889	0.99938405
ENST00000438033	ENST00000510413	IKZF1	chr7	50367353	+	LRBA	chr4	151207186	-	0.000653301	0.9993467
ENST00000439701	ENST00000535741	IKZF1	chr7	50367353	+	LRBA	chr4	151207186	-	0.000577427	0.99942255
ENST00000439701	ENST00000510413	IKZF1	chr7	50367353	+	LRBA	chr4	151207186	-	0.000619592	0.99938035
ENST00000413698	ENST00000535741	IKZF1	chr7	50367353	+	LRBA	chr4	151207186	-	0.000664318	0.9993357
ENST00000413698	ENST00000510413	IKZF1	chr7	50367353	+	LRBA	chr4	151207186	-	0.000719904	0.99928015

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for IKZF1-LRBA

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
IKZF1	chr7	50367353	LRBA	chr4	151207186	315	87	SGGQQSSKSDRVVGETAAPRAILTGH
IKZF1	chr7	50367353	LRBA	chr4	151207186	359	77	SGGQQSSKSDRVVGETAAPRAILTGH
IKZF1	chr7	50367353	LRBA	chr4	151207186	360	77	SGGQQSSKSDRVVGETAAPRAILTGH
IKZF1	chr7	50367353	LRBA	chr4	151207186	369	113	SGGQQSSKSDRVVGETAAPRAILTGH

Top

Potential FusionNeoAntigen Information of IKZF1-LRBA in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

IKZF1-LRBA_50367353_151207186.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	HLA-B39:06	DRVVGETA	0.9995	0.9288	9	17
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	HLA-B39:06	DRVVGETAA	0.9851	0.9271	9	18
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	HLA-A68:03	VVGETAAPR	0.9677	0.8072	11	20
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	HLA-A68:08	VVGETAAPR	0.962	0.8518	11	20
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	HLA-A68:05	VVGETAAPR	0.9551	0.8168	11	20
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	HLA-B73:01	DRVVGETA	0.9985	0.8708	9	17
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	HLA-B73:01	DRVVGETAA	0.9747	0.912	9	18
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	HLA-B40:06	SDRVVGETA	0.9743	0.9016	8	17
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	HLA-A66:02	VVGETAAPR	0.8189	0.7086	11	20

Top

Potential FusionNeoAntigen Information of IKZF1-LRBA in HLA II

IKZF1-LRBA_50367353_151207186.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB1-0303	KSDRVVGETAAPRAI	7	22
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0101	KSDRVVGETAAPRAI	7	22
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0101	SDRVVGETAAPRAIL	8	23
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0101	SKSDRVVGETAAPRA	6	21
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0104	KSDRVVGETAAPRAI	7	22
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0104	SDRVVGETAAPRAIL	8	23
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0105	KSDRVVGETAAPRAI	7	22
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0105	SDRVVGETAAPRAIL	8	23
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0105	SKSDRVVGETAAPRA	6	21
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0106	KSDRVVGETAAPRAI	7	22
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0106	SDRVVGETAAPRAIL	8	23
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0106	SKSDRVVGETAAPRA	6	21
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0106	DRVVGETAAPRAILT	9	24
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0111	KSDRVVGETAAPRAI	7	22
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0111	SDRVVGETAAPRAIL	8	23
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0111	SKSDRVVGETAAPRA	6	21
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0113	KSDRVVGETAAPRAI	7	22
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0113	SDRVVGETAAPRAIL	8	23
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0113	SKSDRVVGETAAPRA	6	21
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0114	KSDRVVGETAAPRAI	7	22
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0114	SDRVVGETAAPRAIL	8	23
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0114	SKSDRVVGETAAPRA	6	21
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0202	KSDRVVGETAAPRAI	7	22
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0202	SDRVVGETAAPRAIL	8	23
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0204	KSDRVVGETAAPRAI	7	22
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0204	SDRVVGETAAPRAIL	8	23
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0204	SKSDRVVGETAAPRA	6	21
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0205	KSDRVVGETAAPRAI	7	22
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0205	SDRVVGETAAPRAIL	8	23
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0205	SKSDRVVGETAAPRA	6	21
IKZF1-LRBA	chr7	50367353	chr4	151207186	315	DRB5-0205	DRVVGETAAPRAILT	9	24

Top

Fusion breakpoint peptide structures of IKZF1-LRBA

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
8709	SKSDRVVGETAAPR	IKZF1	LRBA	chr7	50367353	chr4	151207186	315

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of IKZF1-LRBA

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	8709	SKSDRVVGETAAPR	-7.15543	-7.26883
HLA-B14:02	3BVN	8709	SKSDRVVGETAAPR	-4.77435	-5.80965
HLA-B52:01	3W39	8709	SKSDRVVGETAAPR	-6.80875	-6.92215
HLA-B52:01	3W39	8709	SKSDRVVGETAAPR	-4.20386	-5.23916
HLA-A11:01	4UQ2	8709	SKSDRVVGETAAPR	-7.5194	-8.5547
HLA-A11:01	4UQ2	8709	SKSDRVVGETAAPR	-6.9601	-7.0735
HLA-A24:02	5HGA	8709	SKSDRVVGETAAPR	-7.52403	-7.63743
HLA-A24:02	5HGA	8709	SKSDRVVGETAAPR	-5.82433	-6.85963
HLA-B27:05	6PYJ	8709	SKSDRVVGETAAPR	-3.28285	-4.31815
HLA-B44:05	3DX8	8709	SKSDRVVGETAAPR	-5.91172	-6.94702
HLA-B44:05	3DX8	8709	SKSDRVVGETAAPR	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of IKZF1-LRBA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
IKZF1-LRBA	chr7	50367353	chr4	151207186	11	20	VVGETAAPR	TCGTGGGTGAGACTGCTGCTCCTCGGG
IKZF1-LRBA	chr7	50367353	chr4	151207186	8	17	SDRVVGETA	GTGACAGAGTCGTGGGTGAGACTGCTG
IKZF1-LRBA	chr7	50367353	chr4	151207186	9	17	DRVVGETA	ACAGAGTCGTGGGTGAGACTGCTG
IKZF1-LRBA	chr7	50367353	chr4	151207186	9	18	DRVVGETAA	ACAGAGTCGTGGGTGAGACTGCTGCTC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
IKZF1-LRBA	chr7	50367353	chr4	151207186	6	21	SKSDRVVGETAAPRA	CCAAGAGTGACAGAGTCGTGGGTGAGACTGCTGCTCCTCGGGCCA
IKZF1-LRBA	chr7	50367353	chr4	151207186	7	22	KSDRVVGETAAPRAI	AGAGTGACAGAGTCGTGGGTGAGACTGCTGCTCCTCGGGCCATTT
IKZF1-LRBA	chr7	50367353	chr4	151207186	8	23	SDRVVGETAAPRAIL	GTGACAGAGTCGTGGGTGAGACTGCTGCTCCTCGGGCCATTTTGA
IKZF1-LRBA	chr7	50367353	chr4	151207186	9	24	DRVVGETAAPRAILT	ACAGAGTCGTGGGTGAGACTGCTGCTCCTCGGGCCATTTTGACCG

Top

Information of the samples that have these potential fusion neoantigens of IKZF1-LRBA

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	IKZF1-LRBA	chr7	50367353	ENST00000331340	chr4	151207186	ENST00000510413	TCGA-D8-A27H-01A

Top

Potential target of CAR-T therapy development for IKZF1-LRBA

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to IKZF1-LRBA

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to IKZF1-LRBA

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)