Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:INPP5A-DLG2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: INPP5A-DLG2
	FusionPDB ID: 39805
	FusionGDB2.0 ID: 39805
		Hgene	Tgene
	Gene symbol	INPP5A	DLG2
	Gene ID	3632	4355
	Gene name	inositol polyphosphate-5-phosphatase A	membrane palmitoylated protein 2
	Synonyms	5PTASE	DLG2
	Cytomap	10q26.3	17q21.31
	Type of gene	protein-coding	protein-coding
	Description	inositol polyphosphate-5-phosphatase A43 kDa inositol polyphosphate 5-phophatase43 kDa inositol polyphosphate 5-phosphataseCTCL tumor antigen HD-CL-02InsP3 5-phosphataseinositol polyphosphate-5-phosphatase, 40kDinositol polyphosphate-5-phosphatase,	MAGUK p55 subfamily member 2discs large, homolog 2membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
	Modification date	20200313	20200313
	UniProtAcc	Q14642 Main function of 5'-partner protein: FUNCTION: Phosphatase that specifically hydrolyzes the 5-phosphate of inositol 1,4,5-trisphosphate to inositol 1,4-bisphosphate, and inositol 1,3,4,5-tetrasphosphate to inositol 1,3,4-trisphosphate (PubMed:8013665, PubMed:8769125, PubMed:8626616). Plays a crucial role in the survival of cerebellar Purkinje cells (By similarity). {ECO:0000250\|UniProtKB:Q7TNC9, ECO:0000269\|PubMed:8013665, ECO:0000269\|PubMed:8626616, ECO:0000269\|PubMed:8769125}.	Q15700 Main function of 5'-partner protein: FUNCTION: Required for perception of chronic pain through NMDA receptor signaling. Regulates surface expression of NMDA receptors in dorsal horn neurons of the spinal cord. Interacts with the cytoplasmic tail of NMDA receptor subunits as well as inward rectifying potassium channels. Involved in regulation of synaptic stability at cholinergic synapses. Part of the postsynaptic protein scaffold of excitatory synapses (By similarity). {ECO:0000250}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000368593, ENST00000368594, ENST00000487614,	ENST00000280241, ENST00000330014, ENST00000376106, ENST00000398301, ENST00000398304, ENST00000404783, ENST00000418306, ENST00000426717, ENST00000472545, ENST00000524982, ENST00000530800, ENST00000531015, ENST00000532653, ENST00000537455, ENST00000543673, ENST00000376104, ENST00000398309,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	21 X 9 X 11=2079	45 X 44 X 9=17820
	# samples	21	48
	** MAII score	log2(21/2079*10)=-3.30742852519225 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(48/17820*10)=-5.21431912080077 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: INPP5A [Title/Abstract] AND DLG2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: INPP5A [Title/Abstract] AND DLG2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	INPP5A(134464009)-DLG2(84245774), # samples:3
Anticipated loss of major functional domain due to fusion event.	INPP5A-DLG2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. INPP5A-DLG2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. INPP5A-DLG2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. INPP5A-DLG2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	INPP5A	GO:0046855	inositol phosphate dephosphorylation	8006039

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr10:134464009/chr11:84245774)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across INPP5A (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across DLG2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000368594	INPP5A	chr10	134464009	+	ENST00000398309	DLG2	chr11	84245774	-	7960	583	277	3153	958
ENST00000368594	INPP5A	chr10	134464009	+	ENST00000376104	DLG2	chr11	84245774	-	5053	583	277	3153	958
ENST00000368593	INPP5A	chr10	134464009	+	ENST00000398309	DLG2	chr11	84245774	-	7931	554	248	3124	958
ENST00000368593	INPP5A	chr10	134464009	+	ENST00000376104	DLG2	chr11	84245774	-	5024	554	248	3124	958

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000368594	ENST00000398309	INPP5A	chr10	134464009	+	DLG2	chr11	84245774	-	0.000271907	0.999728
ENST00000368594	ENST00000376104	INPP5A	chr10	134464009	+	DLG2	chr11	84245774	-	0.000558686	0.9994413
ENST00000368593	ENST00000398309	INPP5A	chr10	134464009	+	DLG2	chr11	84245774	-	0.000269602	0.9997304
ENST00000368593	ENST00000376104	INPP5A	chr10	134464009	+	DLG2	chr11	84245774	-	0.000559826	0.99944013

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for INPP5A-DLG2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
INPP5A	chr10	134464009	DLG2	chr11	84245774	554	102	YLDENYKSQEHFTKYRYQDEDAPHDH
INPP5A	chr10	134464009	DLG2	chr11	84245774	583	102	YLDENYKSQEHFTKYRYQDEDAPHDH

Top

Potential FusionNeoAntigen Information of INPP5A-DLG2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

INPP5A-DLG2_134464009_84245774.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:01	SQEHFTKY	0.9992	0.7637	7	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:25	SQEHFTKY	0.9978	0.7584	7	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B18:01	EHFTKYRY	0.9399	0.8723	9	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B44:03	QEHFTKYRY	0.9995	0.9616	8	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:01	KSQEHFTKY	0.9989	0.7701	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B18:01	QEHFTKYRY	0.9986	0.9154	8	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:25	KSQEHFTKY	0.9983	0.7417	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B57:01	KSQEHFTKY	0.9982	0.8767	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:17	KSQEHFTKY	0.9978	0.7357	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B47:01	QEHFTKYRY	0.9977	0.5311	8	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B58:02	KSQEHFTKY	0.9968	0.7808	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B58:01	KSQEHFTKY	0.9959	0.6737	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B57:03	KSQEHFTKY	0.9852	0.8829	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-A30:08	KSQEHFTKY	0.8986	0.6254	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-A32:13	KSQEHFTKY	0.5852	0.8512	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B44:03	SQEHFTKYRY	0.9971	0.9412	7	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:07	SQEHFTKY	0.9982	0.5154	7	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-C15:04	KSQEHFTKY	0.9762	0.7714	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-C07:95	KSQEHFTKY	0.9729	0.5713	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-C07:27	KSQEHFTKY	0.9727	0.9152	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:05	KSQEHFTKY	0.9364	0.6737	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:04	KSQEHFTKY	0.8167	0.7835	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-C03:14	KSQEHFTKY	0.7611	0.9655	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-C12:16	KSQEHFTKY	0.7388	0.8982	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-C12:04	KSQEHFTKY	0.391	0.9836	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-C12:12	KSQEHFTKY	0.3807	0.8521	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-C06:03	KSQEHFTKY	0.3647	0.9863	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-C15:04	YKSQEHFTKY	0.9547	0.7373	5	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:33	SQEHFTKY	0.9992	0.7637	7	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:125	SQEHFTKY	0.9992	0.7637	7	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:34	SQEHFTKY	0.9992	0.7637	7	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:27	SQEHFTKY	0.9992	0.7556	7	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:135	SQEHFTKY	0.9991	0.7598	7	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:12	SQEHFTKY	0.9987	0.7311	7	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:50	SQEHFTKY	0.9985	0.8004	7	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:35	SQEHFTKY	0.9982	0.7326	7	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:39	SQEHFTKY	0.9979	0.5663	7	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:53	SQEHFTKY	0.9935	0.7151	7	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B35:28	SQEHFTKY	0.9842	0.7992	7	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:54	SQEHFTKY	0.9836	0.677	7	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B18:04	SQEHFTKY	0.9524	0.8867	7	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B48:02	SQEHFTKY	0.9451	0.7709	7	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B18:06	EHFTKYRY	0.9438	0.8665	9	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B18:05	EHFTKYRY	0.9399	0.8723	9	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B44:13	QEHFTKYRY	0.9995	0.9616	8	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B44:26	QEHFTKYRY	0.9995	0.9616	8	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B44:07	QEHFTKYRY	0.9995	0.9616	8	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B18:04	QEHFTKYRY	0.999	0.93	8	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:34	KSQEHFTKY	0.9989	0.7701	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:33	KSQEHFTKY	0.9989	0.7701	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:125	KSQEHFTKY	0.9989	0.7701	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:27	KSQEHFTKY	0.9989	0.7783	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:135	KSQEHFTKY	0.9988	0.7777	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B18:07	QEHFTKYRY	0.9988	0.8505	8	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:39	KSQEHFTKY	0.9988	0.564	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B18:05	QEHFTKYRY	0.9986	0.9154	8	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B18:08	QEHFTKYRY	0.9986	0.788	8	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:50	KSQEHFTKY	0.9985	0.8113	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B57:10	KSQEHFTKY	0.9982	0.8767	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B18:06	QEHFTKYRY	0.9977	0.9128	8	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B18:11	QEHFTKYRY	0.9976	0.8988	8	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B58:06	KSQEHFTKY	0.9975	0.5065	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B57:04	KSQEHFTKY	0.9973	0.6195	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:35	KSQEHFTKY	0.9966	0.74	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B18:03	QEHFTKYRY	0.9959	0.9066	8	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:12	KSQEHFTKY	0.9949	0.6597	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:24	KSQEHFTKY	0.9949	0.7487	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-C07:01	KSQEHFTKY	0.985	0.5074	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-C07:22	KSQEHFTKY	0.9795	0.5834	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:53	KSQEHFTKY	0.9792	0.7149	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-C15:09	KSQEHFTKY	0.9762	0.7714	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-C07:17	KSQEHFTKY	0.9629	0.9149	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-A32:01	KSQEHFTKY	0.9552	0.8818	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B57:02	KSQEHFTKY	0.9392	0.7042	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:20	KSQEHFTKY	0.9353	0.8004	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B35:28	KSQEHFTKY	0.9285	0.8143	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-A30:01	KSQEHFTKY	0.905	0.7253	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-C06:06	KSQEHFTKY	0.8703	0.9815	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:54	KSQEHFTKY	0.8392	0.6829	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-C15:02	KSQEHFTKY	0.8372	0.7984	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-C03:02	KSQEHFTKY	0.8197	0.8994	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-C16:02	KSQEHFTKY	0.7306	0.9853	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B48:02	KSQEHFTKY	0.6932	0.7966	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B35:28	QEHFTKYRY	0.6893	0.9269	8	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B35:20	QEHFTKYRY	0.6467	0.9433	8	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-C16:01	KSQEHFTKY	0.6171	0.9626	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-C16:04	KSQEHFTKY	0.5267	0.9687	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-C12:03	KSQEHFTKY	0.4934	0.9469	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-C12:02	KSQEHFTKY	0.3638	0.8961	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:53	QEHFTKYRY	0.335	0.8447	8	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B48:02	QEHFTKYRY	0.2183	0.9097	8	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-C02:10	KSQEHFTKY	0.1903	0.9019	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-C02:02	KSQEHFTKY	0.1903	0.9019	6	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:54	QEHFTKYRY	0.0776	0.8176	8	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:135	SQEHFTKYRY	0.9994	0.7733	7	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:50	SQEHFTKYRY	0.9993	0.7845	7	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:12	SQEHFTKYRY	0.9985	0.7717	7	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:35	SQEHFTKYRY	0.9973	0.7316	7	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B44:13	SQEHFTKYRY	0.9971	0.9412	7	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B44:07	SQEHFTKYRY	0.9971	0.9412	7	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B44:26	SQEHFTKYRY	0.9971	0.9412	7	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:53	SQEHFTKYRY	0.997	0.7378	7	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-C02:10	YKSQEHFTKY	0.9848	0.894	5	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-C02:02	YKSQEHFTKY	0.9848	0.894	5	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:53	YKSQEHFTKY	0.9686	0.6441	5	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-C16:02	YKSQEHFTKY	0.9648	0.9892	5	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B15:54	YKSQEHFTKY	0.9621	0.6133	5	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-C15:09	YKSQEHFTKY	0.9547	0.7373	5	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B18:11	SQEHFTKYRY	0.9469	0.798	7	17
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B48:02	YKSQEHFTKY	0.9212	0.7479	5	15
INPP5A-DLG2	chr10	134464009	chr11	84245774	554	HLA-B57:04	KSQEHFTKYRY	0.9997	0.6563	6	17

Top

Potential FusionNeoAntigen Information of INPP5A-DLG2 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of INPP5A-DLG2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
4607	KSQEHFTKYRYQDE	INPP5A	DLG2	chr10	134464009	chr11	84245774	554

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of INPP5A-DLG2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	4607	KSQEHFTKYRYQDE	-6.15779	-7.19309
HLA-B14:02	3BVN	4607	KSQEHFTKYRYQDE	-5.42154	-5.53494
HLA-B52:01	3W39	4607	KSQEHFTKYRYQDE	-6.31003	-7.34533
HLA-B52:01	3W39	4607	KSQEHFTKYRYQDE	-5.72549	-5.83889
HLA-A11:01	4UQ2	4607	KSQEHFTKYRYQDE	-10.3617	-10.4751
HLA-A11:01	4UQ2	4607	KSQEHFTKYRYQDE	-6.62574	-7.66104
HLA-A24:02	5HGA	4607	KSQEHFTKYRYQDE	-7.32817	-7.44157
HLA-A24:02	5HGA	4607	KSQEHFTKYRYQDE	-5.51285	-6.54815
HLA-B44:05	3DX8	4607	KSQEHFTKYRYQDE	-6.27581	-7.31111
HLA-B44:05	3DX8	4607	KSQEHFTKYRYQDE	-5.0724	-5.1858
HLA-A02:01	6TDR	4607	KSQEHFTKYRYQDE	-2.75053	-2.86393

Top

Vaccine Design for the FusionNeoAntigens of INPP5A-DLG2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
INPP5A-DLG2	chr10	134464009	chr11	84245774	5	15	YKSQEHFTKY	TACAAATCCCAGGAGCACTTCACGAAGTAT
INPP5A-DLG2	chr10	134464009	chr11	84245774	6	15	KSQEHFTKY	AAATCCCAGGAGCACTTCACGAAGTAT
INPP5A-DLG2	chr10	134464009	chr11	84245774	6	17	KSQEHFTKYRY	AAATCCCAGGAGCACTTCACGAAGTATCGATAT
INPP5A-DLG2	chr10	134464009	chr11	84245774	7	15	SQEHFTKY	TCCCAGGAGCACTTCACGAAGTAT
INPP5A-DLG2	chr10	134464009	chr11	84245774	7	17	SQEHFTKYRY	TCCCAGGAGCACTTCACGAAGTATCGATAT
INPP5A-DLG2	chr10	134464009	chr11	84245774	8	17	QEHFTKYRY	CAGGAGCACTTCACGAAGTATCGATAT
INPP5A-DLG2	chr10	134464009	chr11	84245774	9	17	EHFTKYRY	GAGCACTTCACGAAGTATCGATAT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of INPP5A-DLG2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	INPP5A-DLG2	chr10	134464009	ENST00000368593	chr11	84245774	ENST00000376104	TCGA-AR-A0TT-01A

Top

Potential target of CAR-T therapy development for INPP5A-DLG2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to INPP5A-DLG2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to INPP5A-DLG2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)