Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:IST1-RBL2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: IST1-RBL2
	FusionPDB ID: 40334
	FusionGDB2.0 ID: 40334
		Hgene	Tgene
	Gene symbol	IST1	RBL2
	Gene ID	9798	5934
	Gene name	IST1 factor associated with ESCRT-III	RB transcriptional corepressor like 2
	Synonyms	CHMP8\|OLC1	P130\|Rb2
	Cytomap	16q22.2	16q12.2
	Type of gene	protein-coding	protein-coding
	Description	IST1 homologIST1, ESCRT-III associated factorIST1, endosomal sorting complex required for transport-III componentincreased sodium tolerance 1 homologoverexpressed in lung cancer 1putative MAPK-activating protein PM28	retinoblastoma-like protein 2130 kDa retinoblastoma-associated proteinPRB2RBR-2retinoblastoma-like 2retinoblastoma-related protein 2
	Modification date	20200313	20200320
	UniProtAcc	P53990 Main function of 5'-partner protein: FUNCTION: ESCRT-III-like protein involved in specific functions of the ESCRT machinery. Is required for efficient abscission during cytokinesis, but not for HIV-1 budding. The involvement in the MVB pathway is not established. Involved in recruiting VPS4A and/or VPS4B to the midbody of dividing cells (PubMed:19129479, PubMed:19129480). During late anaphase, involved in nuclear envelope reassembly and mitotic spindle disassembly together with the ESCRT-III complex: IST1 acts by mediating the recruitment of SPAST to the nuclear membrane, leading to microtubule severing (PubMed:26040712). Regulates early endosomal tubulation together with the ESCRT-III complex by mediating the recruitment of SPAST (PubMed:23897888). {ECO:0000269\|PubMed:19129479, ECO:0000269\|PubMed:19129480, ECO:0000269\|PubMed:23897888, ECO:0000269\|PubMed:26040712}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000538565, ENST00000329908, ENST00000378798, ENST00000378799, ENST00000535424, ENST00000538850, ENST00000541571, ENST00000544564, ENST00000606369,	ENST00000262133, ENST00000379935, ENST00000544545,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	12 X 6 X 4=288	7 X 6 X 4=168
	# samples	13	7
	** MAII score	log2(13/288*10)=-1.14755718841386 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(7/168*10)=-1.26303440583379 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: IST1 [Title/Abstract] AND RBL2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: IST1 [Title/Abstract] AND RBL2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	IST1(71956583)-RBL2(53493362), # samples:1
Anticipated loss of major functional domain due to fusion event.	IST1-RBL2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. IST1-RBL2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. IST1-RBL2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. IST1-RBL2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	IST1	GO:0009838	abscission	19129479\|19129480
Hgene	IST1	GO:0019076	viral release from host cell	19129479
Hgene	IST1	GO:0045862	positive regulation of proteolysis	20849418
Hgene	IST1	GO:0046745	viral capsid secondary envelopment	19129479
Tgene	RBL2	GO:0043550	regulation of lipid kinase activity	16286473

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr16:71956583/chr16:53493362)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across IST1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across RBL2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000544564	IST1	chr16	71956583	+	ENST00000262133	RBL2	chr16	53493362	+	4671	1081	283	3321	1012
ENST00000541571	IST1	chr16	71956583	+	ENST00000262133	RBL2	chr16	53493362	+	5050	1460	662	3700	1012
ENST00000535424	IST1	chr16	71956583	+	ENST00000262133	RBL2	chr16	53493362	+	4504	914	116	3154	1012
ENST00000378799	IST1	chr16	71956583	+	ENST00000262133	RBL2	chr16	53493362	+	4705	1115	356	3355	999
ENST00000606369	IST1	chr16	71956583	+	ENST00000262133	RBL2	chr16	53493362	+	3967	377	62	2617	851
ENST00000329908	IST1	chr16	71956583	+	ENST00000262133	RBL2	chr16	53493362	+	4411	821	62	3061	999
ENST00000538850	IST1	chr16	71956583	+	ENST00000262133	RBL2	chr16	53493362	+	4034	444	129	2684	851
ENST00000378798	IST1	chr16	71956583	+	ENST00000262133	RBL2	chr16	53493362	+	4401	811	52	3051	999

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000544564	ENST00000262133	IST1	chr16	71956583	+	RBL2	chr16	53493362	+	0.000372804	0.99962723
ENST00000541571	ENST00000262133	IST1	chr16	71956583	+	RBL2	chr16	53493362	+	0.000707369	0.9992926
ENST00000535424	ENST00000262133	IST1	chr16	71956583	+	RBL2	chr16	53493362	+	0.000327887	0.9996722
ENST00000378799	ENST00000262133	IST1	chr16	71956583	+	RBL2	chr16	53493362	+	0.000219544	0.9997805
ENST00000606369	ENST00000262133	IST1	chr16	71956583	+	RBL2	chr16	53493362	+	0.000184158	0.9998159
ENST00000329908	ENST00000262133	IST1	chr16	71956583	+	RBL2	chr16	53493362	+	0.000152512	0.9998474
ENST00000538850	ENST00000262133	IST1	chr16	71956583	+	RBL2	chr16	53493362	+	0.000211723	0.99978834
ENST00000378798	ENST00000262133	IST1	chr16	71956583	+	RBL2	chr16	53493362	+	0.000147771	0.9998522

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for IST1-RBL2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
IST1	chr16	71956583	RBL2	chr16	53493362	1081	266	ANTPFSYPLPKGPSKALRISTPLTGV
IST1	chr16	71956583	RBL2	chr16	53493362	1115	253	ANTPFSYPLPKGPSKALRISTPLTGV
IST1	chr16	71956583	RBL2	chr16	53493362	1460	266	ANTPFSYPLPKGPSKALRISTPLTGV
IST1	chr16	71956583	RBL2	chr16	53493362	377	105	ANTPFSYPLPKGPSKALRISTPLTGV
IST1	chr16	71956583	RBL2	chr16	53493362	444	105	ANTPFSYPLPKGPSKALRISTPLTGV
IST1	chr16	71956583	RBL2	chr16	53493362	811	253	ANTPFSYPLPKGPSKALRISTPLTGV
IST1	chr16	71956583	RBL2	chr16	53493362	821	253	ANTPFSYPLPKGPSKALRISTPLTGV
IST1	chr16	71956583	RBL2	chr16	53493362	914	266	ANTPFSYPLPKGPSKALRISTPLTGV

Top

Potential FusionNeoAntigen Information of IST1-RBL2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

IST1-RBL2_71956583_53493362.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B14:01	LPKGPSKAL	0.9485	0.9598	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B14:02	LPKGPSKAL	0.9485	0.9598	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B08:01	LPKGPSKAL	0.9431	0.8212	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:03	LPKGPSKAL	0.8759	0.8209	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B08:09	LPKGPSKAL	0.8446	0.8057	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:08	LPKGPSKAL	0.8371	0.8252	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:01	LPKGPSKAL	0.8219	0.8507	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B15:37	LPKGPSKAL	0.7369	0.614	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:02	LPKGPSKAL	0.639	0.9669	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:04	LPKGPSKAL	0.639	0.9669	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:05	LPKGPSKAL	0.6023	0.6373	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B15:10	LPKGPSKAL	0.5751	0.5505	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B82:01	LPKGPSKAL	0.258	0.6515	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B81:01	LPKGPSKAL	0.1928	0.6322	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B56:01	YPLPKGPSKA	0.9866	0.5915	6	16
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B07:05	LPKGPSKALR	0.9756	0.5736	8	18
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B07:02	LPKGPSKALR	0.9752	0.529	8	18
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B55:01	YPLPKGPSKA	0.9598	0.5232	6	16
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B08:09	YPLPKGPSKA	0.8731	0.8955	6	16
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B51:02	YPLPKGPSKA	0.702	0.6871	6	16
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B82:01	YPLPKGPSKA	0.5776	0.6394	6	16
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B08:01	YPLPKGPSKAL	0.9995	0.8006	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B07:02	LPKGPSKALRI	0.9995	0.5215	8	19
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B07:05	LPKGPSKALRI	0.9994	0.5384	8	19
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-A11:03	FSYPLPKGPSK	0.9994	0.5115	4	15
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-A03:25	FSYPLPKGPSK	0.9993	0.6664	4	15
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-A03:12	FSYPLPKGPSK	0.9993	0.6968	4	15
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-A30:08	FSYPLPKGPSK	0.999	0.9619	4	15
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:03	YPLPKGPSKAL	0.9984	0.7313	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:01	YPLPKGPSKAL	0.9981	0.7194	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B08:09	YPLPKGPSKAL	0.998	0.8139	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-A34:02	FSYPLPKGPSK	0.9974	0.5009	4	15
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:08	YPLPKGPSKAL	0.9972	0.6635	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:05	YPLPKGPSKAL	0.9957	0.6152	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:02	YPLPKGPSKAL	0.9938	0.9271	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:04	YPLPKGPSKAL	0.9938	0.9271	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B53:01	YPLPKGPSKAL	0.9929	0.5727	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B51:02	YPLPKGPSKAL	0.9898	0.6254	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B81:01	YPLPKGPSKAL	0.9732	0.632	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B51:01	YPLPKGPSKAL	0.9664	0.501	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B42:02	PKGPSKAL	0.9581	0.6835	9	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B42:01	PKGPSKAL	0.9416	0.6754	9	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B42:02	LPKGPSKAL	0.9431	0.8206	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B42:01	LPKGPSKAL	0.9294	0.8121	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B14:03	LPKGPSKAL	0.8843	0.9207	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B07:12	LPKGPSKAL	0.8614	0.5061	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B56:04	LPKGPSKAL	0.817	0.5964	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B54:01	YPLPKGPSK	0.6499	0.5462	6	15
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:12	LPKGPSKAL	0.639	0.9669	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B78:01	LPKGPSKAL	0.5955	0.6082	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B39:10	LPKGPSKAL	0.5254	0.9865	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B54:01	LPKGPSKAL	0.5239	0.6294	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B42:02	YPLPKGPSK	0.3977	0.9377	6	15
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B78:01	YPLPKGPSK	0.2388	0.6587	6	15
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-C01:17	KGPSKALRI	0.0825	0.9758	10	19
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-C01:30	KGPSKALRI	0.0528	0.9758	10	19
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B54:01	YPLPKGPSKA	0.9976	0.8854	6	16
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B42:02	YPLPKGPSKA	0.9461	0.8706	6	16
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B42:01	YPLPKGPSKA	0.9254	0.8647	6	16
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B07:04	LPKGPSKALR	0.9026	0.5522	8	18
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B56:04	YPLPKGPSKA	0.8738	0.8003	6	16
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B42:01	PLPKGPSKAL	0.7362	0.7933	7	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B78:01	YPLPKGPSKA	0.6274	0.6865	6	16
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B39:10	YPLPKGPSKA	0.5922	0.9853	6	16
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B42:01	LPKGPSKALR	0.5595	0.7841	8	18
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B42:02	YPLPKGPSKAL	0.9996	0.8142	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B42:01	YPLPKGPSKAL	0.9996	0.8059	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-A03:01	FSYPLPKGPSK	0.9993	0.6664	4	15
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B56:04	YPLPKGPSKAL	0.9983	0.7469	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B39:10	YPLPKGPSKAL	0.9973	0.9776	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B07:04	LPKGPSKALRI	0.9952	0.5326	8	19
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:12	YPLPKGPSKAL	0.9938	0.9271	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B54:01	YPLPKGPSKAL	0.9912	0.8075	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B42:01	LPKGPSKALRI	0.9766	0.8222	8	19
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B78:01	YPLPKGPSKAL	0.9503	0.638	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B56:05	YPLPKGPS	0.9976	0.5103	6	14
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B56:05	LPKGPSKA	0.9951	0.5356	8	16
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B55:02	LPKGPSKA	0.9822	0.6184	8	16
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B08:18	LPKGPSKAL	0.9431	0.8212	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-C03:67	LPKGPSKAL	0.9152	0.9739	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B59:01	LPKGPSKAL	0.8455	0.5153	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:13	LPKGPSKAL	0.8324	0.8246	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:23	LPKGPSKAL	0.8231	0.8677	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:77	LPKGPSKAL	0.8219	0.8507	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B55:04	LPKGPSKAL	0.8182	0.7884	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B56:02	LPKGPSKAL	0.817	0.5964	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:24	LPKGPSKAL	0.7772	0.8488	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:22	LPKGPSKAL	0.7513	0.6199	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:11	LPKGPSKAL	0.7404	0.8763	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:09	LPKGPSKAL	0.639	0.9669	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B78:02	LPKGPSKAL	0.6279	0.7682	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B08:12	LPKGPSKAL	0.6141	0.8566	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:17	LPKGPSKAL	0.592	0.7583	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:30	LPKGPSKAL	0.592	0.7583	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B67:01	LPKGPSKAL	0.5871	0.9725	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B51:21	LPKGPSKAL	0.4496	0.5227	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-C07:04	LPKGPSKAL	0.3442	0.9828	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B82:02	LPKGPSKAL	0.258	0.6515	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B07:26	YPLPKGPSK	0.1708	0.551	6	15
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B78:02	YPLPKGPSK	0.1479	0.7932	6	15
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-C01:02	KGPSKALRI	0.1077	0.9755	10	19
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B18:07	LPKGPSKAL	0.0617	0.7959	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-C01:03	KGPSKALRI	0.059	0.9758	10	19
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:43	LPKGPSKAL	0.0136	0.8007	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B15:08	LPKGPSKAL	0.0109	0.8007	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B15:11	LPKGPSKAL	0.0096	0.8126	8	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B55:02	YPLPKGPSKA	0.984	0.7561	6	16
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B07:22	LPKGPSKALR	0.9752	0.529	8	18
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-A30:01	SYPLPKGPSK	0.9183	0.9553	5	15
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B56:05	YPLPKGPSKA	0.8975	0.5593	6	16
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B56:02	YPLPKGPSKA	0.8738	0.8003	6	16
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B59:01	YPLPKGPSKA	0.8641	0.9205	6	16
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:22	YPLPKGPSKA	0.8383	0.7586	6	16
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B55:04	YPLPKGPSKA	0.826	0.9247	6	16
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B67:01	YPLPKGPSKA	0.7196	0.984	6	16
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B07:26	LPKGPSKALR	0.654	0.5249	8	18
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B82:02	YPLPKGPSKA	0.5776	0.6394	6	16
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B78:02	YPLPKGPSKA	0.5645	0.781	6	16
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B08:18	YPLPKGPSKAL	0.9995	0.8006	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B07:22	LPKGPSKALRI	0.9995	0.5215	8	19
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-A30:01	FSYPLPKGPSK	0.9989	0.981	4	15
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B55:04	YPLPKGPSKAL	0.9986	0.8471	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B59:01	YPLPKGPSKAL	0.9984	0.8128	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B56:02	YPLPKGPSKAL	0.9983	0.7469	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:13	YPLPKGPSKAL	0.9983	0.7349	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:77	YPLPKGPSKAL	0.9981	0.7194	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B08:12	YPLPKGPSKAL	0.998	0.8354	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:23	YPLPKGPSKAL	0.9978	0.7481	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B67:01	YPLPKGPSKAL	0.9976	0.9744	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B55:02	YPLPKGPSKAL	0.9973	0.6064	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:22	YPLPKGPSKAL	0.9972	0.6964	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B15:08	YPLPKGPSKAL	0.9966	0.7706	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B15:11	YPLPKGPSKAL	0.9962	0.7899	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:17	YPLPKGPSKAL	0.996	0.6723	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:30	YPLPKGPSKAL	0.996	0.6723	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:11	YPLPKGPSKAL	0.9956	0.809	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:43	YPLPKGPSKAL	0.9948	0.7663	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:09	YPLPKGPSKAL	0.9938	0.9271	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B35:24	YPLPKGPSKAL	0.9891	0.7176	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B51:21	YPLPKGPSKAL	0.977	0.6047	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B51:14	YPLPKGPSKAL	0.9678	0.5812	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B78:02	YPLPKGPSKAL	0.9669	0.6932	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B07:26	LPKGPSKALRI	0.9659	0.5635	8	19
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B51:13	YPLPKGPSKAL	0.9645	0.6432	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B51:09	YPLPKGPSKAL	0.9584	0.5089	6	17
IST1-RBL2	chr16	71956583	chr16	53493362	821	HLA-B53:02	YPLPKGPSKAL	0.9548	0.5236	6	17

Top

Potential FusionNeoAntigen Information of IST1-RBL2 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of IST1-RBL2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
10763	YPLPKGPSKALRIS	IST1	RBL2	chr16	71956583	chr16	53493362	821

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of IST1-RBL2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	10763	YPLPKGPSKALRIS	-7.15543	-7.26883
HLA-B14:02	3BVN	10763	YPLPKGPSKALRIS	-4.77435	-5.80965
HLA-B52:01	3W39	10763	YPLPKGPSKALRIS	-6.80875	-6.92215
HLA-B52:01	3W39	10763	YPLPKGPSKALRIS	-4.20386	-5.23916
HLA-A11:01	4UQ2	10763	YPLPKGPSKALRIS	-7.5194	-8.5547
HLA-A11:01	4UQ2	10763	YPLPKGPSKALRIS	-6.9601	-7.0735
HLA-A24:02	5HGA	10763	YPLPKGPSKALRIS	-7.52403	-7.63743
HLA-A24:02	5HGA	10763	YPLPKGPSKALRIS	-5.82433	-6.85963
HLA-B27:05	6PYJ	10763	YPLPKGPSKALRIS	-3.28285	-4.31815
HLA-B44:05	3DX8	10763	YPLPKGPSKALRIS	-5.91172	-6.94702
HLA-B44:05	3DX8	10763	YPLPKGPSKALRIS	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of IST1-RBL2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
IST1-RBL2	chr16	71956583	chr16	53493362	10	19	KGPSKALRI	AAGGGACCATCCAAAGCACTTAGAATC
IST1-RBL2	chr16	71956583	chr16	53493362	4	15	FSYPLPKGPSK	TTCTCATATCCACTGCCAAAGGGACCATCCAAA
IST1-RBL2	chr16	71956583	chr16	53493362	5	15	SYPLPKGPSK	TCATATCCACTGCCAAAGGGACCATCCAAA
IST1-RBL2	chr16	71956583	chr16	53493362	6	14	YPLPKGPS	TATCCACTGCCAAAGGGACCATCC
IST1-RBL2	chr16	71956583	chr16	53493362	6	15	YPLPKGPSK	TATCCACTGCCAAAGGGACCATCCAAA
IST1-RBL2	chr16	71956583	chr16	53493362	6	16	YPLPKGPSKA	TATCCACTGCCAAAGGGACCATCCAAAGCA
IST1-RBL2	chr16	71956583	chr16	53493362	6	17	YPLPKGPSKAL	TATCCACTGCCAAAGGGACCATCCAAAGCACTT
IST1-RBL2	chr16	71956583	chr16	53493362	7	17	PLPKGPSKAL	CCACTGCCAAAGGGACCATCCAAAGCACTT
IST1-RBL2	chr16	71956583	chr16	53493362	8	16	LPKGPSKA	CTGCCAAAGGGACCATCCAAAGCA
IST1-RBL2	chr16	71956583	chr16	53493362	8	17	LPKGPSKAL	CTGCCAAAGGGACCATCCAAAGCACTT
IST1-RBL2	chr16	71956583	chr16	53493362	8	18	LPKGPSKALR	CTGCCAAAGGGACCATCCAAAGCACTTAGA
IST1-RBL2	chr16	71956583	chr16	53493362	8	19	LPKGPSKALRI	CTGCCAAAGGGACCATCCAAAGCACTTAGAATC
IST1-RBL2	chr16	71956583	chr16	53493362	9	17	PKGPSKAL	CCAAAGGGACCATCCAAAGCACTT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of IST1-RBL2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
ESCA	IST1-RBL2	chr16	71956583	ENST00000329908	chr16	53493362	ENST00000262133	TCGA-L5-A893

Top

Potential target of CAR-T therapy development for IST1-RBL2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to IST1-RBL2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to IST1-RBL2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)