|
|||||||
|
Fusion Protein:ITGA3-CASC3 |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: ITGA3-CASC3 | FusionPDB ID: 40418 | FusionGDB2.0 ID: 40418 | Hgene | Tgene | Gene symbol | ITGA3 | CASC3 | Gene ID | 3675 | 22794 |
| Gene name | integrin subunit alpha 3 | CASC3 exon junction complex subunit | |
| Synonyms | CD49C|FRP-2|GAP-B3|GAPB3|ILNEB|MSK18|VCA-2|VL3A|VLA3a | BTZ|MLN51 | |
| Cytomap | 17q21.33 | 17q21.1 | |
| Type of gene | protein-coding | protein-coding | |
| Description | integrin alpha-3CD49 antigen-like family member Calpha 3 subunit of VLA-3 receptorantigen CD49Cantigen identified by monoclonal antibody J143galactoprotein B3integrin alpha 3integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)testi | protein CASC3MLN 51barentszcancer susceptibility 3cancer susceptibility candidate 3cancer susceptibility candidate gene 3 proteinmetastatic lymph node 51metastatic lymph node gene 51 proteinprotein barentsz | |
| Modification date | 20200320 | 20200313 | |
| UniProtAcc | P26006 Main function of 5'-partner protein: FUNCTION: Integrin alpha-3/beta-1 is a receptor for fibronectin, laminin, collagen, epiligrin, thrombospondin and CSPG4. Integrin alpha-3/beta-1 provides a docking site for FAP (seprase) at invadopodia plasma membranes in a collagen-dependent manner and hence may participate in the adhesion, formation of invadopodia and matrix degradation processes, promoting cell invasion. Alpha-3/beta-1 may mediate with LGALS3 the stimulation by CSPG4 of endothelial cells migration. {ECO:0000269|PubMed:10455171, ECO:0000269|PubMed:15181153}. | O15234 Main function of 5'-partner protein: FUNCTION: Required for pre-mRNA splicing as component of the spliceosome (PubMed:28502770, PubMed:29301961). Core component of the splicing-dependent multiprotein exon junction complex (EJC) deposited at splice junctions on mRNAs. The EJC is a dynamic structure consisting of core proteins and several peripheral nuclear and cytoplasmic associated factors that join the complex only transiently either during EJC assembly or during subsequent mRNA metabolism. The EJC marks the position of the exon-exon junction in the mature mRNA for the gene expression machinery and the core components remain bound to spliced mRNAs throughout all stages of mRNA metabolism thereby influencing downstream processes including nuclear mRNA export, subcellular mRNA localization, translation efficiency and nonsense-mediated mRNA decay (NMD). Stimulates the ATPase and RNA-helicase activities of EIF4A3. Plays a role in the stress response by participating in cytoplasmic stress granules assembly and by favoring cell recovery following stress. Component of the dendritic ribonucleoprotein particles (RNPs) in hippocampal neurons. May play a role in mRNA transport. Binds spliced mRNA in sequence-independent manner, 20-24 nucleotides upstream of mRNA exon-exon junctions. Binds poly(G) and poly(U) RNA homopolymer. {ECO:0000269|PubMed:17375189, ECO:0000269|PubMed:17652158, ECO:0000269|PubMed:28502770, ECO:0000269|PubMed:29301961}. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000007722, ENST00000320031, ENST00000544892, | ENST00000264645, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 9 X 10 X 7=630 | 10 X 5 X 5=250 |
| # samples | 9 | 10 | |
| ** MAII score | log2(9/630*10)=-2.8073549220576 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(10/250*10)=-1.32192809488736 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: ITGA3 [Title/Abstract] AND CASC3 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: ITGA3 [Title/Abstract] AND CASC3 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | ITGA3(48158772)-CASC3(38318006), # samples:1 | ||
| Anticipated loss of major functional domain due to fusion event. | ITGA3-CASC3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ITGA3-CASC3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ITGA3-CASC3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ITGA3-CASC3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | ITGA3 | GO:1903078 | positive regulation of protein localization to plasma membrane | 10455171 |
| Tgene | CASC3 | GO:0000398 | mRNA splicing, via spliceosome | 29301961 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:48158772/chr17:38318006) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across ITGA3 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across CASC3 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000320031 | ITGA3 | chr17 | 48158772 | + | ENST00000264645 | CASC3 | chr17 | 38318006 | + | 6842 | 3249 | 174 | 5063 | 1629 |
| ENST00000007722 | ITGA3 | chr17 | 48158772 | + | ENST00000264645 | CASC3 | chr17 | 38318006 | + | 6512 | 2919 | 0 | 4733 | 1577 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000320031 | ENST00000264645 | ITGA3 | chr17 | 48158772 | + | CASC3 | chr17 | 38318006 | + | 0.000997052 | 0.999003 |
| ENST00000007722 | ENST00000264645 | ITGA3 | chr17 | 48158772 | + | CASC3 | chr17 | 38318006 | + | 0.000675638 | 0.99932444 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for ITGA3-CASC3 |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| ITGA3 | chr17 | 48158772 | CASC3 | chr17 | 38318006 | 2919 | 973 | SIPTINMENKTTWGEEGEYSEEENSK |
| ITGA3 | chr17 | 48158772 | CASC3 | chr17 | 38318006 | 3249 | 1025 | SIPTINMENKTTWGEEGEYSEEENSK |
Top |
Potential FusionNeoAntigen Information of ITGA3-CASC3 in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| ITGA3-CASC3_48158772_38318006.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| ITGA3-CASC3 | chr17 | 48158772 | chr17 | 38318006 | 2919 | HLA-B15:31 | TTWGEEGEY | 0.903 | 0.9846 | 10 | 19 |
| ITGA3-CASC3 | chr17 | 48158772 | chr17 | 38318006 | 2919 | HLA-B35:20 | TTWGEEGEY | 0.8981 | 0.9882 | 10 | 19 |
Top |
Potential FusionNeoAntigen Information of ITGA3-CASC3 in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of ITGA3-CASC3 |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 5888 | MENKTTWGEEGEYS | ITGA3 | CASC3 | chr17 | 48158772 | chr17 | 38318006 | 2919 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ITGA3-CASC3 |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 5888 | MENKTTWGEEGEYS | -7.15543 | -7.26883 |
| HLA-B14:02 | 3BVN | 5888 | MENKTTWGEEGEYS | -4.77435 | -5.80965 |
| HLA-B52:01 | 3W39 | 5888 | MENKTTWGEEGEYS | -6.80875 | -6.92215 |
| HLA-B52:01 | 3W39 | 5888 | MENKTTWGEEGEYS | -4.20386 | -5.23916 |
| HLA-A11:01 | 4UQ2 | 5888 | MENKTTWGEEGEYS | -7.5194 | -8.5547 |
| HLA-A11:01 | 4UQ2 | 5888 | MENKTTWGEEGEYS | -6.9601 | -7.0735 |
| HLA-A24:02 | 5HGA | 5888 | MENKTTWGEEGEYS | -7.52403 | -7.63743 |
| HLA-A24:02 | 5HGA | 5888 | MENKTTWGEEGEYS | -5.82433 | -6.85963 |
| HLA-B27:05 | 6PYJ | 5888 | MENKTTWGEEGEYS | -3.28285 | -4.31815 |
| HLA-B44:05 | 3DX8 | 5888 | MENKTTWGEEGEYS | -5.91172 | -6.94702 |
| HLA-B44:05 | 3DX8 | 5888 | MENKTTWGEEGEYS | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of ITGA3-CASC3 |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| ITGA3-CASC3 | chr17 | 48158772 | chr17 | 38318006 | 10 | 19 | TTWGEEGEY | ACCACGTGGGGTGAAGAAGGTGAATAC |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of ITGA3-CASC3 |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| BLCA | ITGA3-CASC3 | chr17 | 48158772 | ENST00000007722 | chr17 | 38318006 | ENST00000264645 | TCGA-XF-A8HH-01A |
Top |
Potential target of CAR-T therapy development for ITGA3-CASC3 |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to ITGA3-CASC3 |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to ITGA3-CASC3 |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies