Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ITGA7-MYRFL

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ITGA7-MYRFL
	FusionPDB ID: 40453
	FusionGDB2.0 ID: 40453
		Hgene	Tgene
	Gene symbol	ITGA7	MYRFL
	Gene ID	3679	196446
	Gene name	integrin subunit alpha 7	myelin regulatory factor like
	Synonyms	-	C12orf15\|C12orf28\|bcm1377
	Cytomap	12q13.2	12q15
	Type of gene	protein-coding	protein-coding
	Description	integrin alpha-7integrin alpha 7 chain	myelin regulatory factor-like protein
	Modification date	20200328	20200322
	UniProtAcc	Q13683 Main function of 5'-partner protein: FUNCTION: Integrin alpha-7/beta-1 is the primary laminin receptor on skeletal myoblasts and adult myofibers. During myogenic differentiation, it may induce changes in the shape and mobility of myoblasts, and facilitate their localization at laminin-rich sites of secondary fiber formation. It is involved in the maintenance of the myofibers cytoarchitecture as well as for their anchorage, viability and functional integrity. Isoform Alpha-7X2B and isoform Alpha-7X1B promote myoblast migration on laminin 1 and laminin 2/4, but isoform Alpha-7X1B is less active on laminin 1 (In vitro). Acts as Schwann cell receptor for laminin-2. Acts as a receptor of COMP and mediates its effect on vascular smooth muscle cells (VSMCs) maturation (By similarity). Required to promote contractile phenotype acquisition in differentiated airway smooth muscle (ASM) cells. {ECO:0000250, ECO:0000269\|PubMed:10694445, ECO:0000269\|PubMed:17641293, ECO:0000269\|PubMed:9307969}.	Q96LU7 Main function of 5'-partner protein:
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000257879, ENST00000257880, ENST00000347027, ENST00000394229, ENST00000394230, ENST00000452168, ENST00000553804, ENST00000555728,	ENST00000535034, ENST00000299350, ENST00000547771, ENST00000552032,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	7 X 8 X 5=280	29 X 16 X 7=3248
	# samples	8	26
	** MAII score	log2(8/280*10)=-1.8073549220576 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(26/3248*10)=-3.64296810415672 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ITGA7 [Title/Abstract] AND MYRFL [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ITGA7 [Title/Abstract] AND MYRFL [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ITGA7(56089306)-MYRFL(70349143), # samples:2
Anticipated loss of major functional domain due to fusion event.	ITGA7-MYRFL seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ITGA7-MYRFL seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr12:56089306/chr12:70349143)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ITGA7 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across MYRFL (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000553804	ITGA7	chr12	56089306	-	ENST00000552032	MYRFL	chr12	70349143	+	2584	2034	19	2391	790
ENST00000553804	ITGA7	chr12	56089306	-	ENST00000547771	MYRFL	chr12	70349143	+	2958	2034	19	2391	790
ENST00000553804	ITGA7	chr12	56089306	-	ENST00000299350	MYRFL	chr12	70349143	+	2584	2034	19	2391	790
ENST00000257879	ITGA7	chr12	56089306	-	ENST00000552032	MYRFL	chr12	70349143	+	2769	2219	78	2576	832
ENST00000257879	ITGA7	chr12	56089306	-	ENST00000547771	MYRFL	chr12	70349143	+	3143	2219	78	2576	832
ENST00000257879	ITGA7	chr12	56089306	-	ENST00000299350	MYRFL	chr12	70349143	+	2769	2219	78	2576	832
ENST00000347027	ITGA7	chr12	56089306	-	ENST00000552032	MYRFL	chr12	70349143	+	2737	2187	64	2544	826
ENST00000347027	ITGA7	chr12	56089306	-	ENST00000547771	MYRFL	chr12	70349143	+	3111	2187	64	2544	826
ENST00000347027	ITGA7	chr12	56089306	-	ENST00000299350	MYRFL	chr12	70349143	+	2737	2187	64	2544	826
ENST00000452168	ITGA7	chr12	56089306	-	ENST00000552032	MYRFL	chr12	70349143	+	2416	1866	31	2223	730
ENST00000452168	ITGA7	chr12	56089306	-	ENST00000547771	MYRFL	chr12	70349143	+	2790	1866	31	2223	730
ENST00000452168	ITGA7	chr12	56089306	-	ENST00000299350	MYRFL	chr12	70349143	+	2416	1866	31	2223	730
ENST00000394229	ITGA7	chr12	56089306	-	ENST00000552032	MYRFL	chr12	70349143	+	2773	2223	82	2580	832
ENST00000394229	ITGA7	chr12	56089306	-	ENST00000547771	MYRFL	chr12	70349143	+	3147	2223	82	2580	832
ENST00000394229	ITGA7	chr12	56089306	-	ENST00000299350	MYRFL	chr12	70349143	+	2773	2223	82	2580	832
ENST00000257880	ITGA7	chr12	56089306	-	ENST00000552032	MYRFL	chr12	70349143	+	2905	2355	82	2712	876
ENST00000257880	ITGA7	chr12	56089306	-	ENST00000547771	MYRFL	chr12	70349143	+	3279	2355	82	2712	876
ENST00000257880	ITGA7	chr12	56089306	-	ENST00000299350	MYRFL	chr12	70349143	+	2905	2355	82	2712	876
ENST00000394230	ITGA7	chr12	56089306	-	ENST00000552032	MYRFL	chr12	70349143	+	2785	2235	82	2592	836
ENST00000394230	ITGA7	chr12	56089306	-	ENST00000547771	MYRFL	chr12	70349143	+	3159	2235	82	2592	836
ENST00000394230	ITGA7	chr12	56089306	-	ENST00000299350	MYRFL	chr12	70349143	+	2785	2235	82	2592	836
ENST00000555728	ITGA7	chr12	56089306	-	ENST00000552032	MYRFL	chr12	70349143	+	2714	2164	29	2521	830
ENST00000555728	ITGA7	chr12	56089306	-	ENST00000547771	MYRFL	chr12	70349143	+	3088	2164	29	2521	830
ENST00000555728	ITGA7	chr12	56089306	-	ENST00000299350	MYRFL	chr12	70349143	+	2714	2164	29	2521	830

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000553804	ENST00000552032	ITGA7	chr12	56089306	-	MYRFL	chr12	70349143	+	0.002221433	0.9977786
ENST00000553804	ENST00000547771	ITGA7	chr12	56089306	-	MYRFL	chr12	70349143	+	0.001355118	0.9986449
ENST00000553804	ENST00000299350	ITGA7	chr12	56089306	-	MYRFL	chr12	70349143	+	0.002221433	0.9977786
ENST00000257879	ENST00000552032	ITGA7	chr12	56089306	-	MYRFL	chr12	70349143	+	0.003181865	0.99681807
ENST00000257879	ENST00000547771	ITGA7	chr12	56089306	-	MYRFL	chr12	70349143	+	0.001995472	0.9980045
ENST00000257879	ENST00000299350	ITGA7	chr12	56089306	-	MYRFL	chr12	70349143	+	0.003181865	0.99681807
ENST00000347027	ENST00000552032	ITGA7	chr12	56089306	-	MYRFL	chr12	70349143	+	0.003867135	0.99613285
ENST00000347027	ENST00000547771	ITGA7	chr12	56089306	-	MYRFL	chr12	70349143	+	0.002468076	0.9975319
ENST00000347027	ENST00000299350	ITGA7	chr12	56089306	-	MYRFL	chr12	70349143	+	0.003867135	0.99613285
ENST00000452168	ENST00000552032	ITGA7	chr12	56089306	-	MYRFL	chr12	70349143	+	0.001724193	0.99827576
ENST00000452168	ENST00000547771	ITGA7	chr12	56089306	-	MYRFL	chr12	70349143	+	0.000968772	0.9990312
ENST00000452168	ENST00000299350	ITGA7	chr12	56089306	-	MYRFL	chr12	70349143	+	0.001724193	0.99827576
ENST00000394229	ENST00000552032	ITGA7	chr12	56089306	-	MYRFL	chr12	70349143	+	0.003151476	0.9968485
ENST00000394229	ENST00000547771	ITGA7	chr12	56089306	-	MYRFL	chr12	70349143	+	0.001975857	0.9980241
ENST00000394229	ENST00000299350	ITGA7	chr12	56089306	-	MYRFL	chr12	70349143	+	0.003151476	0.9968485
ENST00000257880	ENST00000552032	ITGA7	chr12	56089306	-	MYRFL	chr12	70349143	+	0.00201828	0.99798167
ENST00000257880	ENST00000547771	ITGA7	chr12	56089306	-	MYRFL	chr12	70349143	+	0.001235829	0.99876416
ENST00000257880	ENST00000299350	ITGA7	chr12	56089306	-	MYRFL	chr12	70349143	+	0.00201828	0.99798167
ENST00000394230	ENST00000552032	ITGA7	chr12	56089306	-	MYRFL	chr12	70349143	+	0.002442509	0.9975575
ENST00000394230	ENST00000547771	ITGA7	chr12	56089306	-	MYRFL	chr12	70349143	+	0.001473711	0.9985262
ENST00000394230	ENST00000299350	ITGA7	chr12	56089306	-	MYRFL	chr12	70349143	+	0.002442509	0.9975575
ENST00000555728	ENST00000552032	ITGA7	chr12	56089306	-	MYRFL	chr12	70349143	+	0.001927259	0.99807274
ENST00000555728	ENST00000547771	ITGA7	chr12	56089306	-	MYRFL	chr12	70349143	+	0.001198336	0.9988017
ENST00000555728	ENST00000299350	ITGA7	chr12	56089306	-	MYRFL	chr12	70349143	+	0.001927259	0.99807274

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ITGA7-MYRFL

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ITGA7	chr12	56089306	MYRFL	chr12	70349143	1866	612	TRVSDTEFQPLPISGNYNYNIPVNKH
ITGA7	chr12	56089306	MYRFL	chr12	70349143	2034	672	TRVSDTEFQPLPISGNYNYNIPVNKH
ITGA7	chr12	56089306	MYRFL	chr12	70349143	2164	712	TRVSDTEFQPLPISGNYNYNIPVNKH
ITGA7	chr12	56089306	MYRFL	chr12	70349143	2187	708	TRVSDTEFQPLPISGNYNYNIPVNKH
ITGA7	chr12	56089306	MYRFL	chr12	70349143	2219	714	TRVSDTEFQPLPISGNYNYNIPVNKH
ITGA7	chr12	56089306	MYRFL	chr12	70349143	2223	714	TRVSDTEFQPLPISGNYNYNIPVNKH
ITGA7	chr12	56089306	MYRFL	chr12	70349143	2235	718	TRVSDTEFQPLPISGNYNYNIPVNKH
ITGA7	chr12	56089306	MYRFL	chr12	70349143	2355	758	TRVSDTEFQPLPISGNYNYNIPVNKH

Top

Potential FusionNeoAntigen Information of ITGA7-MYRFL in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ITGA7-MYRFL_56089306_70349143.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:01	LPISGNYNY	0.9987	0.7384	10	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:08	LPISGNYNY	0.9977	0.8015	10	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B50:02	TEFQPLPIS	0.9902	0.6962	5	14
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:02	LPISGNYNY	0.9898	0.8202	10	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B45:01	TEFQPLPIS	0.988	0.9832	5	14
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:01	QPLPISGNY	0.9802	0.8005	8	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:08	QPLPISGNY	0.9674	0.838	8	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:02	QPLPISGNY	0.941	0.8634	8	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:03	LPISGNYNY	0.9076	0.7277	10	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:04	LPISGNYNY	0.5006	0.6998	10	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:02	LPISGNYNY	0.5006	0.6998	10	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B41:01	TEFQPLPIS	0.386	0.9912	5	14
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B50:01	TEFQPLPIS	0.2321	0.7701	5	14
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:01	FQPLPISGNY	0.9998	0.7755	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:25	FQPLPISGNY	0.9896	0.8192	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:02	FQPLPISGNY	0.9821	0.8287	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:01	FQPLPISGNY	0.9593	0.8032	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:08	FQPLPISGNY	0.9578	0.8357	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:05	FQPLPISGNY	0.8078	0.5353	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:01	QPLPISGNYNY	0.9863	0.7649	8	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:08	QPLPISGNYNY	0.9836	0.7964	8	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:31	LPISGNYNY	0.9985	0.6704	10	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B40:06	TEFQPLPIS	0.9973	0.8071	5	14
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:21	LPISGNYNY	0.9898	0.7909	10	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:31	QPLPISGNY	0.981	0.7887	8	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:21	QPLPISGNY	0.9456	0.8375	8	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:12	LPISGNYNY	0.5006	0.6998	10	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:21	FQPLPISGNY	0.9824	0.8014	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:04	FQPLPISGNY	0.9808	0.7629	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:31	FQPLPISGNY	0.9566	0.7914	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:05	FQPLPISGNY	0.9159	0.7826	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:77	LPISGNYNY	0.9987	0.7384	10	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:23	LPISGNYNY	0.9987	0.6912	10	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:20	LPISGNYNY	0.9984	0.7737	10	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:24	LPISGNYNY	0.9951	0.7247	10	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:11	LPISGNYNY	0.9897	0.7786	10	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:23	QPLPISGNY	0.9803	0.8082	8	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:77	QPLPISGNY	0.9802	0.8005	8	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:20	QPLPISGNY	0.9789	0.843	8	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:24	QPLPISGNY	0.9463	0.7449	8	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:11	QPLPISGNY	0.9434	0.8351	8	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B18:04	LPISGNYNY	0.8777	0.7333	10	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:17	QPLPISGNY	0.8729	0.6258	8	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:30	QPLPISGNY	0.8729	0.6258	8	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:13	QPLPISGNY	0.7148	0.6224	8	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B18:04	QPLPISGNY	0.5954	0.6969	8	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B18:07	LPISGNYNY	0.5213	0.6882	10	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:08	QPLPISGNY	0.5096	0.7141	8	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:09	LPISGNYNY	0.5006	0.6998	10	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:11	QPLPISGNY	0.4996	0.7233	8	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B18:08	LPISGNYNY	0.465	0.5192	10	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:43	QPLPISGNY	0.4539	0.7158	8	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:08	LPISGNYNY	0.4525	0.6651	10	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:11	LPISGNYNY	0.4398	0.6497	10	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:43	LPISGNYNY	0.3957	0.6626	10	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B50:05	TEFQPLPIS	0.2321	0.7701	5	14
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B50:04	TEFQPLPIS	0.2321	0.7701	5	14
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B18:07	QPLPISGNY	0.2009	0.6255	8	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:33	FQPLPISGNY	0.9998	0.7755	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:135	FQPLPISGNY	0.9998	0.7948	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:125	FQPLPISGNY	0.9998	0.7755	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:27	FQPLPISGNY	0.9998	0.8082	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:34	FQPLPISGNY	0.9998	0.7755	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:50	FQPLPISGNY	0.9997	0.862	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:11	FQPLPISGNY	0.9995	0.7502	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:53	FQPLPISGNY	0.9995	0.7421	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:24	FQPLPISGNY	0.9994	0.7422	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:08	FQPLPISGNY	0.9994	0.7437	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:35	FQPLPISGNY	0.9993	0.7334	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:43	FQPLPISGNY	0.9993	0.7421	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:12	FQPLPISGNY	0.9983	0.833	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:54	FQPLPISGNY	0.9971	0.7116	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:39	FQPLPISGNY	0.99	0.6981	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:11	FQPLPISGNY	0.9822	0.8007	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:77	FQPLPISGNY	0.9593	0.8032	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:23	FQPLPISGNY	0.9561	0.8099	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:20	FQPLPISGNY	0.9537	0.8279	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:20	FQPLPISGNY	0.9191	0.8242	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:28	FQPLPISGNY	0.9029	0.8215	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:24	FQPLPISGNY	0.8683	0.8244	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:30	FQPLPISGNY	0.8658	0.6727	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:17	FQPLPISGNY	0.8658	0.6727	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B18:07	FQPLPISGNY	0.583	0.7628	7	17
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:77	QPLPISGNYNY	0.9863	0.7649	8	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:23	QPLPISGNYNY	0.9856	0.7721	8	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B15:11	QPLPISGNYNY	0.9787	0.6685	8	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:11	QPLPISGNYNY	0.9702	0.8044	8	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:17	QPLPISGNYNY	0.9626	0.6038	8	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:30	QPLPISGNYNY	0.9626	0.6038	8	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	HLA-B35:24	QPLPISGNYNY	0.9619	0.7107	8	19

Top

Potential FusionNeoAntigen Information of ITGA7-MYRFL in HLA II

ITGA7-MYRFL_56089306_70349143.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	DRB1-1001	DTEFQPLPISGNYNY	4	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	DRB1-1001	SDTEFQPLPISGNYN	3	18
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	DRB1-1003	DTEFQPLPISGNYNY	4	19
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	DRB1-1003	SDTEFQPLPISGNYN	3	18
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	DRB1-1525	PLPISGNYNYNIPVN	9	24
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	DRB3-0202	PISGNYNYNIPVNKH	11	26
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	DRB3-0205	PISGNYNYNIPVNKH	11	26
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	DRB3-0210	PISGNYNYNIPVNKH	11	26
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	DRB3-0211	PISGNYNYNIPVNKH	11	26
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	DRB3-0212	PISGNYNYNIPVNKH	11	26
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	DRB3-0217	PISGNYNYNIPVNKH	11	26
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	DRB3-0218	PISGNYNYNIPVNKH	11	26
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	DRB3-0219	PISGNYNYNIPVNKH	11	26
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	DRB3-0220	PISGNYNYNIPVNKH	11	26
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	DRB3-0222	PISGNYNYNIPVNKH	11	26
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	DRB3-0223	PISGNYNYNIPVNKH	11	26
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	DRB3-0225	PISGNYNYNIPVNKH	11	26
ITGA7-MYRFL	chr12	56089306	chr12	70349143	2219	DRB3-0301	PLPISGNYNYNIPVN	9	24

Top

Fusion breakpoint peptide structures of ITGA7-MYRFL

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
1720	EFQPLPISGNYNYN	ITGA7	MYRFL	chr12	56089306	chr12	70349143	2219

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ITGA7-MYRFL

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	1720	EFQPLPISGNYNYN	-7.9962	-8.1096
HLA-B14:02	3BVN	1720	EFQPLPISGNYNYN	-5.70842	-6.74372
HLA-B52:01	3W39	1720	EFQPLPISGNYNYN	-6.83737	-6.95077
HLA-B52:01	3W39	1720	EFQPLPISGNYNYN	-4.4836	-5.5189
HLA-A11:01	4UQ2	1720	EFQPLPISGNYNYN	-10.0067	-10.1201
HLA-A11:01	4UQ2	1720	EFQPLPISGNYNYN	-9.03915	-10.0745
HLA-A24:02	5HGA	1720	EFQPLPISGNYNYN	-6.56204	-6.67544
HLA-A24:02	5HGA	1720	EFQPLPISGNYNYN	-5.42271	-6.45801
HLA-B44:05	3DX8	1720	EFQPLPISGNYNYN	-7.85648	-8.89178
HLA-B44:05	3DX8	1720	EFQPLPISGNYNYN	-5.3978	-5.5112
HLA-A02:01	6TDR	1720	EFQPLPISGNYNYN	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of ITGA7-MYRFL

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ITGA7-MYRFL	chr12	56089306	chr12	70349143	10	19	LPISGNYNY	TCTGCCCATATCTGGAAATTATAATTA
ITGA7-MYRFL	chr12	56089306	chr12	70349143	5	14	TEFQPLPIS	CACGGAATTCCAACCTCTGCCCATATC
ITGA7-MYRFL	chr12	56089306	chr12	70349143	7	17	FQPLPISGNY	ATTCCAACCTCTGCCCATATCTGGAAATTA
ITGA7-MYRFL	chr12	56089306	chr12	70349143	8	17	QPLPISGNY	CCAACCTCTGCCCATATCTGGAAATTA
ITGA7-MYRFL	chr12	56089306	chr12	70349143	8	19	QPLPISGNYNY	CCAACCTCTGCCCATATCTGGAAATTATAATTA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
ITGA7-MYRFL	chr12	56089306	chr12	70349143	11	26	PISGNYNYNIPVNKH	GCCCATATCTGGAAATTATAATTACAATATTCCTGTTAATAAACA
ITGA7-MYRFL	chr12	56089306	chr12	70349143	3	18	SDTEFQPLPISGNYN	CAGCGACACGGAATTCCAACCTCTGCCCATATCTGGAAATTATAA
ITGA7-MYRFL	chr12	56089306	chr12	70349143	4	19	DTEFQPLPISGNYNY	CGACACGGAATTCCAACCTCTGCCCATATCTGGAAATTATAATTA
ITGA7-MYRFL	chr12	56089306	chr12	70349143	9	24	PLPISGNYNYNIPVN	ACCTCTGCCCATATCTGGAAATTATAATTACAATATTCCTGTTAA

Top

Information of the samples that have these potential fusion neoantigens of ITGA7-MYRFL

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
SARC	ITGA7-MYRFL	chr12	56089306	ENST00000257879	chr12	70349143	ENST00000299350	TCGA-DX-A2IZ-01A

Top

Potential target of CAR-T therapy development for ITGA7-MYRFL

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ITGA7-MYRFL

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ITGA7-MYRFL

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)