Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ITPR3-SNX14

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ITPR3-SNX14
	FusionPDB ID: 40727
	FusionGDB2.0 ID: 40727
		Hgene	Tgene
	Gene symbol	ITPR3	SNX14
	Gene ID	3710	57231
	Gene name	inositol 1,4,5-trisphosphate receptor type 3	sorting nexin 14
	Synonyms	IP3R\|IP3R3	RGS-PX2\|SCAR20
	Cytomap	6p21.31	6q14.3
	Type of gene	protein-coding	protein-coding
	Description	inositol 1,4,5-trisphosphate receptor type 3IP3 receptorinositol 1,4,5-triphosphate receptor, type 3insP3R3type 3 InsP3 receptor	sorting nexin-14
	Modification date	20200313	20200313
	UniProtAcc	Q14573 Main function of 5'-partner protein: FUNCTION: Receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000374316, ENST00000605930,	ENST00000369627, ENST00000508980, ENST00000505648, ENST00000513865, ENST00000314673, ENST00000346348,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	14 X 13 X 8=1456	8 X 8 X 3=192
	# samples	15	8
	** MAII score	log2(15/1456*10)=-3.27897594970282 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(8/192*10)=-1.26303440583379 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ITPR3 [Title/Abstract] AND SNX14 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ITPR3 [Title/Abstract] AND SNX14 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ITPR3(33623664)-SNX14(86235955), # samples:1
Anticipated loss of major functional domain due to fusion event.	ITPR3-SNX14 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ITPR3-SNX14 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	ITPR3	GO:0051592	response to calcium ion	19052258

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr6:33623664/chr6:86235955)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ITPR3 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across SNX14 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000374316	ITPR3	chr6	33623664	+	ENST00000346348	SNX14	chr6	86235955	-	2659	1342	1060	2187	375
ENST00000374316	ITPR3	chr6	33623664	+	ENST00000314673	SNX14	chr6	86235955	-	2656	1342	1060	2187	375
ENST00000605930	ITPR3	chr6	33623664	+	ENST00000346348	SNX14	chr6	86235955	-	1818	501	219	1346	375
ENST00000605930	ITPR3	chr6	33623664	+	ENST00000314673	SNX14	chr6	86235955	-	1815	501	219	1346	375

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000374316	ENST00000346348	ITPR3	chr6	33623664	+	SNX14	chr6	86235955	-	0.000736587	0.99926347
ENST00000374316	ENST00000314673	ITPR3	chr6	33623664	+	SNX14	chr6	86235955	-	0.000744057	0.99925596
ENST00000605930	ENST00000346348	ITPR3	chr6	33623664	+	SNX14	chr6	86235955	-	0.000297039	0.999703
ENST00000605930	ENST00000314673	ITPR3	chr6	33623664	+	SNX14	chr6	86235955	-	0.000300589	0.9996995

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ITPR3-SNX14

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ITPR3	chr6	33623664	SNX14	chr6	86235955	1342	94	EKIADVVLLQKLQKLLQHPELSNSQL
ITPR3	chr6	33623664	SNX14	chr6	86235955	501	94	EKIADVVLLQKLQKLLQHPELSNSQL

Top

Potential FusionNeoAntigen Information of ITPR3-SNX14 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ITPR3-SNX14_33623664_86235955.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-B08:01	LLQKLQKL	0.9983	0.6145	7	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-B39:24	QKLLQHPEL	0.9987	0.6154	12	21
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-B39:01	QKLLQHPEL	0.9979	0.9352	12	21
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-B14:01	QKLLQHPEL	0.9973	0.8811	12	21
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-B14:02	QKLLQHPEL	0.9973	0.8811	12	21
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-B39:13	QKLLQHPEL	0.9939	0.9563	12	21
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-A02:24	VLLQKLQKL	0.9859	0.5987	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-A02:30	VLLQKLQKL	0.9859	0.5987	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-A02:67	VLLQKLQKL	0.9859	0.5987	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-A02:22	VLLQKLQKL	0.9857	0.5865	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-A02:60	VLLQKLQKL	0.9855	0.5858	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-A02:11	VLLQKLQKL	0.9851	0.6414	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-A02:21	VLLQKLQKL	0.9804	0.7269	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-A02:13	VLLQKLQKL	0.9785	0.7229	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-A02:04	VLLQKLQKL	0.9783	0.6754	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-A02:27	VLLQKLQKL	0.9765	0.625	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-B08:01	VLLQKLQKL	0.9627	0.7677	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-A02:38	VLLQKLQKL	0.9622	0.5857	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-A30:08	VVLLQKLQK	0.95	0.553	5	14
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-B15:10	QKLLQHPEL	0.9202	0.617	12	21
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-B08:09	VLLQKLQKL	0.9183	0.7366	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-A02:19	VLLQKLQKL	0.8592	0.5041	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-A32:13	VLLQKLQKL	0.8383	0.9421	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-A02:29	VLLQKLQKL	0.8204	0.6025	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-A02:20	VLLQKLQKL	0.8162	0.6028	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-A02:35	VLLQKLQKL	0.7846	0.6196	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-B48:01	QKLLQHPEL	0.7667	0.7171	12	21
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-B15:37	QKLLQHPEL	0.7004	0.5953	12	21
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-B13:02	VLLQKLQKL	0.0765	0.5464	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-B13:01	VLLQKLQKL	0.0549	0.846	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-B39:09	QKLLQHPEL	0.9982	0.7602	12	21
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-B39:12	QKLLQHPEL	0.9974	0.9461	12	21
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-B39:05	QKLLQHPEL	0.9946	0.9295	12	21
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-A02:07	VLLQKLQKL	0.9868	0.6027	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-A02:01	VLLQKLQKL	0.9859	0.5987	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-A02:05	VLLQKLQKL	0.9824	0.5799	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-B14:03	QKLLQHPEL	0.6059	0.783	12	21
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-B48:03	QKLLQHPEL	0.3055	0.606	12	21
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-C07:29	VLLQKLQKL	0.2958	0.9497	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-C01:30	VLLQKLQKL	0.0895	0.9613	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-B08:18	LLQKLQKL	0.9983	0.6145	7	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-B39:02	QKLLQHPEL	0.9979	0.9523	12	21
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-B39:31	QKLLQHPEL	0.9978	0.9422	12	21
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-A02:14	VLLQKLQKL	0.9807	0.6683	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-A02:06	VLLQKLQKL	0.9804	0.7269	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-A02:03	VLLQKLQKL	0.9802	0.7098	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-B08:18	VLLQKLQKL	0.9627	0.7677	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-A30:01	VVLLQKLQK	0.9506	0.744	5	14
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-A32:01	VLLQKLQKL	0.9143	0.9487	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-B15:09	QKLLQHPEL	0.8662	0.8037	12	21
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-C06:06	VLLQKLQKL	0.6334	0.9903	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-B08:12	VLLQKLQKL	0.6107	0.9001	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-C07:04	VLLQKLQKL	0.551	0.9467	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-C03:67	VLLQKLQKL	0.4736	0.9686	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-C17:01	VLLQKLQKL	0.3444	0.8462	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-B15:73	VLLQKLQKL	0.3426	0.7883	6	15
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-B40:12	QKLLQHPEL	0.3055	0.606	12	21
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	HLA-B15:30	VLLQKLQKL	0.2412	0.7857	6	15

Top

Potential FusionNeoAntigen Information of ITPR3-SNX14 in HLA II

ITPR3-SNX14_33623664_86235955.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-0828	VVLLQKLQKLLQHPE	5	20
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-0831	VVLLQKLQKLLQHPE	5	20
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-1104	VVLLQKLQKLLQHPE	5	20
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-1106	VVLLQKLQKLLQHPE	5	20
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-1118	VVLLQKLQKLLQHPE	5	20
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-1125	VVLLQKLQKLLQHPE	5	20
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-1135	VVLLQKLQKLLQHPE	5	20
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-1138	VVLLQKLQKLLQHPE	5	20
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-1142	VVLLQKLQKLLQHPE	5	20
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-1143	VVLLQKLQKLLQHPE	5	20
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-1144	VVLLQKLQKLLQHPE	5	20
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-1146	VVLLQKLQKLLQHPE	5	20
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-1147	VVLLQKLQKLLQHPE	5	20
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-1157	VVLLQKLQKLLQHPE	5	20
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-1158	VVLLQKLQKLLQHPE	5	20
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-1160	VVLLQKLQKLLQHPE	5	20
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-1167	VVLLQKLQKLLQHPE	5	20
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-1172	VVLLQKLQKLLQHPE	5	20
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-1177	VVLLQKLQKLLQHPE	5	20
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-1178	VVLLQKLQKLLQHPE	5	20
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-1184	VVLLQKLQKLLQHPE	5	20
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-1192	VVLLQKLQKLLQHPE	5	20
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-1192	DVVLLQKLQKLLQHP	4	19
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-1204	VVLLQKLQKLLQHPE	5	20
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-1209	VVLLQKLQKLLQHPE	5	20
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-1306	VVLLQKLQKLLQHPE	5	20
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-1311	VVLLQKLQKLLQHPE	5	20
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-1318	VVLLQKLQKLLQHPE	5	20
ITPR3-SNX14	chr6	33623664	chr6	86235955	1342	DRB1-1342	VVLLQKLQKLLQHPE	5	20

Top

Fusion breakpoint peptide structures of ITPR3-SNX14

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
10084	VLLQKLQKLLQHPE	ITPR3	SNX14	chr6	33623664	chr6	86235955	1342

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ITPR3-SNX14

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele

PDB ID

File name

BPseq

Docking score

Glide score

Top

Vaccine Design for the FusionNeoAntigens of ITPR3-SNX14

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ITPR3-SNX14	chr6	33623664	chr6	86235955	12	21	QKLLQHPEL	CAGAAACTTCTGCAGCATCCAGAACTG
ITPR3-SNX14	chr6	33623664	chr6	86235955	5	14	VVLLQKLQK	GTGGTGTTGCTGCAGAAGCTGCAGAAA
ITPR3-SNX14	chr6	33623664	chr6	86235955	6	15	VLLQKLQKL	GTGTTGCTGCAGAAGCTGCAGAAACTT
ITPR3-SNX14	chr6	33623664	chr6	86235955	7	15	LLQKLQKL	TTGCTGCAGAAGCTGCAGAAACTT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
ITPR3-SNX14	chr6	33623664	chr6	86235955	4	19	DVVLLQKLQKLLQHP	GATGTGGTGTTGCTGCAGAAGCTGCAGAAACTTCTGCAGCATCCA
ITPR3-SNX14	chr6	33623664	chr6	86235955	5	20	VVLLQKLQKLLQHPE	GTGGTGTTGCTGCAGAAGCTGCAGAAACTTCTGCAGCATCCAGAA

Top

Information of the samples that have these potential fusion neoantigens of ITPR3-SNX14

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	ITPR3-SNX14	chr6	33623664	ENST00000374316	chr6	86235955	ENST00000314673	TCGA-CD-8531-01A

Top

Potential target of CAR-T therapy development for ITPR3-SNX14

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ITPR3-SNX14

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ITPR3-SNX14

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)