Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:KCNK5-PDE4DIP

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: KCNK5-PDE4DIP
	FusionPDB ID: 41474
	FusionGDB2.0 ID: 41474
		Hgene	Tgene
	Gene symbol	KCNK5	PDE4DIP
	Gene ID	8645	9659
	Gene name	potassium two pore domain channel subfamily K member 5	phosphodiesterase 4D interacting protein
	Synonyms	K2p5.1\|KCNK5b\|TASK-2\|TASK2	CMYA2\|MMGL
	Cytomap	6p21.2	1q21.2
	Type of gene	protein-coding	protein-coding
	Description	potassium channel subfamily K member 5K2P5.1 potassium channelTWIK-related acid-sensitive K(+) channel 2TWIK-related acid-sensitive K+ 2TWIK-related acid-sensitive K+ channel 2acid-sensitive potassium channel protein TASK-2potassium channel, subfami	myomegalincardiomyopathy-associated protein 2myomegalin/phosphodiesterase 4D interacting protein variant 8
	Modification date	20200313	20200313
	UniProtAcc	O95279 Main function of 5'-partner protein: FUNCTION: pH-dependent, voltage insensitive, outwardly rectifying potassium channel. Outward rectification is lost at high external K(+) concentrations.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000359534,	ENST00000313431, ENST00000369345, ENST00000478649, ENST00000479408, ENST00000493130, ENST00000524974, ENST00000529945, ENST00000313382, ENST00000369347, ENST00000369348, ENST00000369349, ENST00000369351, ENST00000369354, ENST00000369356, ENST00000369359, ENST00000530740,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	3 X 2 X 3=18	12 X 9 X 8=864
	# samples	3	13
	** MAII score	log2(3/18*10)=0.736965594166206 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0	log2(13/864*10)=-2.73251968913501 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: KCNK5 [Title/Abstract] AND PDE4DIP [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: KCNK5 [Title/Abstract] AND PDE4DIP [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	KCNK5(39196702)-PDE4DIP(144994701), # samples:3
Anticipated loss of major functional domain due to fusion event.	KCNK5-PDE4DIP seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KCNK5-PDE4DIP seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	PDE4DIP	GO:1903358	regulation of Golgi organization	27666745

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr6:39196702/chr1:144994701)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across KCNK5 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across PDE4DIP (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000359534	KCNK5	chr6	39196702	-	ENST00000313382	PDE4DIP	chr1	144994701	+	8054	525	339	7019	2226
ENST00000359534	KCNK5	chr6	39196702	-	ENST00000369354	PDE4DIP	chr1	144994701	+	8567	525	6467	7969	500
ENST00000359534	KCNK5	chr6	39196702	-	ENST00000369356	PDE4DIP	chr1	144994701	+	8511	525	6411	7913	500
ENST00000359534	KCNK5	chr6	39196702	-	ENST00000530740	PDE4DIP	chr1	144994701	+	8350	525	339	7379	2346
ENST00000359534	KCNK5	chr6	39196702	-	ENST00000369359	PDE4DIP	chr1	144994701	+	8503	525	339	7532	2397
ENST00000359534	KCNK5	chr6	39196702	-	ENST00000369351	PDE4DIP	chr1	144994701	+	5308	525	3208	4710	500
ENST00000359534	KCNK5	chr6	39196702	-	ENST00000369349	PDE4DIP	chr1	144994701	+	5027	525	2927	4429	500
ENST00000359534	KCNK5	chr6	39196702	-	ENST00000369347	PDE4DIP	chr1	144994701	+	1454	525	339	704	121
ENST00000359534	KCNK5	chr6	39196702	-	ENST00000369348	PDE4DIP	chr1	144994701	+	1450	525	339	1016	225

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000359534	ENST00000313382	KCNK5	chr6	39196702	-	PDE4DIP	chr1	144994701	+	0.00772583	0.9922741
ENST00000359534	ENST00000369354	KCNK5	chr6	39196702	-	PDE4DIP	chr1	144994701	+	0.004795586	0.99520445
ENST00000359534	ENST00000369356	KCNK5	chr6	39196702	-	PDE4DIP	chr1	144994701	+	0.004916741	0.99508333
ENST00000359534	ENST00000530740	KCNK5	chr6	39196702	-	PDE4DIP	chr1	144994701	+	0.006700244	0.9932997
ENST00000359534	ENST00000369359	KCNK5	chr6	39196702	-	PDE4DIP	chr1	144994701	+	0.005864215	0.99413574
ENST00000359534	ENST00000369351	KCNK5	chr6	39196702	-	PDE4DIP	chr1	144994701	+	0.004743462	0.9952565
ENST00000359534	ENST00000369349	KCNK5	chr6	39196702	-	PDE4DIP	chr1	144994701	+	0.005877482	0.99412256
ENST00000359534	ENST00000369347	KCNK5	chr6	39196702	-	PDE4DIP	chr1	144994701	+	0.008215942	0.9917841
ENST00000359534	ENST00000369348	KCNK5	chr6	39196702	-	PDE4DIP	chr1	144994701	+	0.000749887	0.9992501

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for KCNK5-PDE4DIP

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
KCNK5	chr6	39196702	PDE4DIP	chr1	144994701	525	1416	AEELRSASWPGKYDSLIQDQARELSY
KCNK5	chr6	39196702	PDE4DIP	chr1	144994701	525	1525	AEELRSASWPGKYDSLIQDQARELSY
KCNK5	chr6	39196702	PDE4DIP	chr1	144994701	525	50	VTPTGCLGKQTDQDLSATLLCKLGPG
KCNK5	chr6	39196702	PDE4DIP	chr1	144994701	525	62	PCLGQEGLDKILEHLNDLKKENFSLK

Top

Potential FusionNeoAntigen Information of KCNK5-PDE4DIP in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

KCNK5-PDE4DIP_39196702_144994701.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:22	GLDKILEHL	0.9946	0.521	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:24	GLDKILEHL	0.9934	0.6312	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:67	GLDKILEHL	0.9934	0.6312	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:30	GLDKILEHL	0.9934	0.6312	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:60	GLDKILEHL	0.9933	0.6427	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:11	GLDKILEHL	0.9929	0.6947	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:16	GLDKILEHL	0.9925	0.5317	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:27	GLDKILEHL	0.9922	0.6187	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:04	GLDKILEHL	0.9891	0.7445	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:13	GLDKILEHL	0.9889	0.7456	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:21	GLDKILEHL	0.9886	0.7491	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:38	GLDKILEHL	0.9881	0.8094	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:22	KILEHLNDL	0.9874	0.6969	9	18
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:17	GLDKILEHL	0.9852	0.5839	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:60	KILEHLNDL	0.9829	0.7543	9	18
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:30	KILEHLNDL	0.9829	0.7734	9	18
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:67	KILEHLNDL	0.9829	0.7734	9	18
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:24	KILEHLNDL	0.9829	0.7734	9	18
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:11	KILEHLNDL	0.9828	0.8001	9	18
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:04	KILEHLNDL	0.9815	0.7609	9	18
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:17	KILEHLNDL	0.9806	0.5352	9	18
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:21	KILEHLNDL	0.9782	0.8569	9	18
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:27	KILEHLNDL	0.9721	0.6549	9	18
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:38	KILEHLNDL	0.9704	0.6137	9	18
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:19	GLDKILEHL	0.9704	0.5741	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:16	KILEHLNDL	0.965	0.6205	9	18
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:13	KILEHLNDL	0.9616	0.7255	9	18
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:35	KILEHLNDL	0.9406	0.7936	9	18
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:29	KILEHLNDL	0.8803	0.7769	9	18
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:35	GLDKILEHL	0.8791	0.6509	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:20	KILEHLNDL	0.8509	0.7769	9	18
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:29	GLDKILEHL	0.8202	0.6352	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:20	GLDKILEHL	0.816	0.6425	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-B13:01	GLDKILEHL	0.2901	0.9344	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A74:03	KILEHLNDLK	0.8657	0.5273	9	19
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A74:11	KILEHLNDLK	0.8657	0.5273	9	19
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A74:09	KILEHLNDLK	0.8657	0.5273	9	19
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-B38:01	EHLNDLKKENF	0.999	0.878	12	23
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-B38:02	EHLNDLKKENF	0.9989	0.8977	12	23
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A74:03	KILEHLNDLKK	0.9822	0.525	9	20
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A74:11	KILEHLNDLKK	0.9822	0.525	9	20
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A74:09	KILEHLNDLKK	0.9822	0.525	9	20
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-C05:09	GLDKILEHL	1	0.9755	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-C04:07	GLDKILEHL	0.9999	0.9472	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-C04:10	GLDKILEHL	0.9999	0.9424	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-C08:15	GLDKILEHL	0.9999	0.9898	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:07	GLDKILEHL	0.9936	0.6311	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:01	GLDKILEHL	0.9934	0.6312	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:05	KILEHLNDL	0.9849	0.5509	9	18
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:01	KILEHLNDL	0.9829	0.7734	9	18
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-C04:06	GLDKILEHL	0.975	0.9648	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-B39:08	GLDKILEHL	0.4108	0.961	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-C04:03	GLDKILEHL	1	0.953	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-C05:01	GLDKILEHL	1	0.9755	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-C08:02	GLDKILEHL	0.9999	0.9898	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-C18:01	GLDKILEHL	0.9999	0.9459	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-C04:01	GLDKILEHL	0.9999	0.9472	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:06	GLDKILEHL	0.9886	0.7491	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:14	GLDKILEHL	0.9885	0.6563	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:03	GLDKILEHL	0.9884	0.6692	6	15
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:14	KILEHLNDL	0.9794	0.7879	9	18
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:03	KILEHLNDL	0.979	0.7772	9	18
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A02:06	KILEHLNDL	0.9782	0.8569	9	18
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A74:01	KILEHLNDLK	0.8657	0.5273	9	19
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-B38:05	EHLNDLKKENF	0.999	0.878	12	23
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	525	HLA-A74:01	KILEHLNDLKK	0.9822	0.525	9	20

Top

Potential FusionNeoAntigen Information of KCNK5-PDE4DIP in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of KCNK5-PDE4DIP

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
2928	GLDKILEHLNDLKK	KCNK5	PDE4DIP	chr6	39196702	chr1	144994701	525

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of KCNK5-PDE4DIP

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	2928	GLDKILEHLNDLKK	-6.12283	-6.12283
HLA-A24:02	5HGA	2928	GLDKILEHLNDLKK	-7.36995	-7.36995

Top

Vaccine Design for the FusionNeoAntigens of KCNK5-PDE4DIP

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	12	23	EHLNDLKKENF	GAGCACCTCAATGACCTGAAGAAGGAGAACTTC
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	6	15	GLDKILEHL	GGCCTGGACAAGATCCTAGAGCACCTC
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	9	18	KILEHLNDL	AAGATCCTAGAGCACCTCAATGACCTG
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	9	19	KILEHLNDLK	AAGATCCTAGAGCACCTCAATGACCTGAAG
KCNK5-PDE4DIP	chr6	39196702	chr1	144994701	9	20	KILEHLNDLKK	AAGATCCTAGAGCACCTCAATGACCTGAAGAAG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of KCNK5-PDE4DIP

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LUAD	KCNK5-PDE4DIP	chr6	39196702	ENST00000359534	chr1	144994701	ENST00000313382	TCGA-91-A4BC-01A

Top

Potential target of CAR-T therapy development for KCNK5-PDE4DIP

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Hgene

KCNK5

chr6:39196702

chr1:144994701

ENST00000359534

8_26

500.0

Transmembrane

Helical

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to KCNK5-PDE4DIP

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to KCNK5-PDE4DIP

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)