Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:KDM4A-EGLN1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: KDM4A-EGLN1
	FusionPDB ID: 41779
	FusionGDB2.0 ID: 41779
		Hgene	Tgene
	Gene symbol	KDM4A	EGLN1
	Gene ID	9682	54583
	Gene name	lysine demethylase 4A	egl-9 family hypoxia inducible factor 1
	Synonyms	JHDM3A\|JMJD2\|JMJD2A\|TDRD14A	C1orf12\|ECYT3\|HALAH\|HIF-PH2\|HIFPH2\|HPH-2\|HPH2\|PHD2\|SM20\|ZMYND6
	Cytomap	1p34.2-p34.1	1q42.2
	Type of gene	protein-coding	protein-coding
	Description	lysine-specific demethylase 4AjmjC domain-containing histone demethylation protein 3Ajumonji C domain-containing histone demethylase 3Ajumonji domain containing 2jumonji domain containing 2Ajumonji domain-containing protein 2Alysine (K)-specific dem	egl nine homolog 1HIF-prolyl hydroxylase 2egl nine-like protein 1hypoxia-inducible factor prolyl hydroxylase 2prolyl hydroxylase domain-containing protein 2zinc finger MYND domain-containing protein 6
	Modification date	20200313	20200313
	UniProtAcc	O75164 Main function of 5'-partner protein: FUNCTION: Histone demethylase that specifically demethylates 'Lys-9' and 'Lys-36' residues of histone H3, thereby playing a central role in histone code (PubMed:26741168). Does not demethylate histone H3 'Lys-4', H3 'Lys-27' nor H4 'Lys-20'. Demethylates trimethylated H3 'Lys-9' and H3 'Lys-36' residue, while it has no activity on mono- and dimethylated residues. Demethylation of Lys residue generates formaldehyde and succinate. Participates in transcriptional repression of ASCL2 and E2F-responsive promoters via the recruitment of histone deacetylases and NCOR1, respectively. {ECO:0000269\|PubMed:16024779, ECO:0000269\|PubMed:16603238, ECO:0000269\|PubMed:26741168}.; FUNCTION: [Isoform 2]: Crucial for muscle differentiation, promotes transcriptional activation of the Myog gene by directing the removal of repressive chromatin marks at its promoter. Lacks the N-terminal demethylase domain. {ECO:0000269\|PubMed:21694756}.	Q9GZT9 Main function of 5'-partner protein: FUNCTION: Cellular oxygen sensor that catalyzes, under normoxic conditions, the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. Hydroxylates a specific proline found in each of the oxygen-dependent degradation (ODD) domains (N-terminal, NODD, and C-terminal, CODD) of HIF1A. Also hydroxylates HIF2A. Has a preference for the CODD site for both HIF1A and HIF1B. Hydroxylated HIFs are then targeted for proteasomal degradation via the von Hippel-Lindau ubiquitination complex. Under hypoxic conditions, the hydroxylation reaction is attenuated allowing HIFs to escape degradation resulting in their translocation to the nucleus, heterodimerization with HIF1B, and increased expression of hypoxy-inducible genes. EGLN1 is the most important isozyme under normoxia and, through regulating the stability of HIF1, involved in various hypoxia-influenced processes such as angiogenesis in retinal and cardiac functionality. Target proteins are preferentially recognized via a LXXLAP motif. {ECO:0000269\|PubMed:11595184, ECO:0000269\|PubMed:12181324, ECO:0000269\|PubMed:12351678, ECO:0000269\|PubMed:15897452, ECO:0000269\|PubMed:19339211, ECO:0000269\|PubMed:21792862, ECO:0000269\|PubMed:25129147}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000463151, ENST00000372396,	ENST00000366641, ENST00000476717,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	13 X 11 X 10=1430	7 X 4 X 5=140
	# samples	15	7
	** MAII score	log2(15/1430*10)=-3.25298074116987 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(7/140*10)=-1 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: KDM4A [Title/Abstract] AND EGLN1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: KDM4A [Title/Abstract] AND EGLN1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	KDM4A(44126083)-EGLN1(231509845), # samples:1
Anticipated loss of major functional domain due to fusion event.	KDM4A-EGLN1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KDM4A-EGLN1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KDM4A-EGLN1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. KDM4A-EGLN1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	KDM4A	GO:0016577	histone demethylation	16024779
Hgene	KDM4A	GO:0045892	negative regulation of transcription, DNA-templated	16024779
Hgene	KDM4A	GO:0070544	histone H3-K36 demethylation	21914792
Tgene	EGLN1	GO:0001666	response to hypoxia	16956324
Tgene	EGLN1	GO:0018401	peptidyl-proline hydroxylation to 4-hydroxy-L-proline	11598268
Tgene	EGLN1	GO:0032364	oxygen homeostasis	16956324
Tgene	EGLN1	GO:0043433	negative regulation of DNA-binding transcription factor activity	16956324
Tgene	EGLN1	GO:0071731	response to nitric oxide	21601578

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:44126083/chr1:231509845)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across KDM4A (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across EGLN1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst

Tenst

Hgene

Hchr

Hbp

Hstrand

Tgene

Tchr

Tbp

Tstrand

Seq length
(transcript)

BP loci
(transcript)

Predicted start
(transcript)

Predicted stop
(transcript)

Seq length
(amino acids)

ENST00000372396

KDM4A

chr1

44126083

ENST00000366641

EGLN1

chr1

231509845

3613

563

134

952

272

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000372396	ENST00000366641	KDM4A	chr1	44126083	+	EGLN1	chr1	231509845	-	0.000193508	0.99980646

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for KDM4A-EGLN1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
KDM4A	chr1	44126083	EGLN1	chr1	231509845	563	143	IYGADVNGTLYEKAMVACYPGNGTGY

Top

Potential FusionNeoAntigen Information of KDM4A-EGLN1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

KDM4A-EGLN1_44126083_231509845.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B08:09	TLYEKAMV	0.9975	0.6244	8	16
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B18:01	YEKAMVACY	0.9963	0.9162	10	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-A02:22	TLYEKAMVA	0.996	0.5425	8	17
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-A02:13	TLYEKAMVA	0.996	0.7575	8	17
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-A02:27	TLYEKAMVA	0.9943	0.6322	8	17
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-A02:38	TLYEKAMVA	0.9937	0.7628	8	17
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-A02:16	TLYEKAMVA	0.9931	0.5294	8	17
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-A02:11	TLYEKAMVA	0.9899	0.6437	8	17
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-A02:67	TLYEKAMVA	0.9897	0.6128	8	17
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-A02:30	TLYEKAMVA	0.9897	0.6128	8	17
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-A02:24	TLYEKAMVA	0.9897	0.6128	8	17
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-A02:60	TLYEKAMVA	0.9894	0.5381	8	17
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-A02:21	TLYEKAMVA	0.9869	0.7415	8	17
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B44:03	YEKAMVACY	0.984	0.9301	10	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-A02:19	TLYEKAMVA	0.9837	0.5061	8	17
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B08:09	TLYEKAMVA	0.9826	0.723	8	17
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B08:01	TLYEKAMVA	0.9788	0.5248	8	17
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-A02:04	TLYEKAMVA	0.9784	0.7324	8	17
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-A02:35	TLYEKAMVA	0.9757	0.6381	8	17
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-A02:29	TLYEKAMVA	0.9729	0.617	8	17
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-A02:20	TLYEKAMVA	0.9657	0.6227	8	17
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B47:01	YEKAMVACY	0.92	0.5538	10	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B15:01	TLYEKAMVACY	0.9988	0.9202	8	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B15:25	TLYEKAMVACY	0.9894	0.8974	8	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B15:02	TLYEKAMVACY	0.9799	0.9089	8	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-A02:01	TLYEKAMVA	0.9897	0.6128	8	17
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B15:04	TLYEKAMVA	0.7509	0.9247	8	17
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B15:31	YEKAMVACY	0.695	0.8812	10	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B15:07	TLYEKAMVACY	0.9975	0.7569	8	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-A02:03	TLYEKAMVA	0.9983	0.7195	8	17
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B18:04	YEKAMVACY	0.9979	0.9231	10	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B18:07	YEKAMVACY	0.9969	0.843	10	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B18:08	YEKAMVACY	0.9964	0.9194	10	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B18:05	YEKAMVACY	0.9963	0.9162	10	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B18:03	YEKAMVACY	0.9949	0.9089	10	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B18:06	YEKAMVACY	0.9949	0.9128	10	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-A02:06	TLYEKAMVA	0.9869	0.7415	8	17
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B44:07	YEKAMVACY	0.984	0.9301	10	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B44:26	YEKAMVACY	0.984	0.9301	10	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B44:13	YEKAMVACY	0.984	0.9301	10	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B08:18	TLYEKAMVA	0.9788	0.5248	8	17
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B18:11	YEKAMVACY	0.9504	0.8811	10	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B15:53	YEKAMVACY	0.7782	0.8477	10	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B15:12	YEKAMVACY	0.7462	0.8975	10	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B35:20	YEKAMVACY	0.6847	0.9478	10	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B35:28	YEKAMVACY	0.6833	0.9393	10	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B15:54	YEKAMVACY	0.3891	0.8334	10	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B15:68	YEKAMVACY	0.1834	0.6075	10	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B48:02	YEKAMVACY	0.1362	0.9231	10	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-A02:03	GTLYEKAMVA	0.9514	0.5432	7	17
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B15:33	TLYEKAMVACY	0.9988	0.9202	8	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B15:50	TLYEKAMVACY	0.9988	0.9442	8	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B15:135	TLYEKAMVACY	0.9988	0.942	8	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B15:125	TLYEKAMVACY	0.9988	0.9202	8	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B15:34	TLYEKAMVACY	0.9988	0.9202	8	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B15:27	TLYEKAMVACY	0.9988	0.9285	8	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B15:35	TLYEKAMVACY	0.9969	0.9191	8	19
KDM4A-EGLN1	chr1	44126083	chr1	231509845	563	HLA-B15:39	TLYEKAMVACY	0.9902	0.8417	8	19

Top

Potential FusionNeoAntigen Information of KDM4A-EGLN1 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of KDM4A-EGLN1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
6171	NGTLYEKAMVACYP	KDM4A	EGLN1	chr1	44126083	chr1	231509845	563

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of KDM4A-EGLN1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B52:01	3W39	6171	NGTLYEKAMVACYP	-7.90165	-7.90165
HLA-B44:05	3DX8	6171	NGTLYEKAMVACYP	-5.81679	-5.81679

Top

Vaccine Design for the FusionNeoAntigens of KDM4A-EGLN1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
KDM4A-EGLN1	chr1	44126083	chr1	231509845	10	19	YEKAMVACY	TATGAAAAGGCCATGGTTGCTTGTTAT
KDM4A-EGLN1	chr1	44126083	chr1	231509845	7	17	GTLYEKAMVA	GGTACCCTCTATGAAAAGGCCATGGTTGCT
KDM4A-EGLN1	chr1	44126083	chr1	231509845	8	16	TLYEKAMV	ACCCTCTATGAAAAGGCCATGGTT
KDM4A-EGLN1	chr1	44126083	chr1	231509845	8	17	TLYEKAMVA	ACCCTCTATGAAAAGGCCATGGTTGCT
KDM4A-EGLN1	chr1	44126083	chr1	231509845	8	19	TLYEKAMVACY	ACCCTCTATGAAAAGGCCATGGTTGCTTGTTAT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of KDM4A-EGLN1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LUSC	KDM4A-EGLN1	chr1	44126083	ENST00000372396	chr1	231509845	ENST00000366641	TCGA-43-8115-01A

Top

Potential target of CAR-T therapy development for KDM4A-EGLN1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to KDM4A-EGLN1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to KDM4A-EGLN1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)